ID: 977569718

View in Genome Browser
Species Human (GRCh38)
Location 4:98616526-98616548
Sequence TCTTGCCATCCAGCGCCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977569718_977569721 8 Left 977569718 4:98616526-98616548 CCAAGAGGCGCTGGATGGCAAGA 0: 1
1: 0
2: 0
3: 1
4: 118
Right 977569721 4:98616557-98616579 GCACAGCCTCCACTCTCAAGGGG 0: 1
1: 0
2: 0
3: 24
4: 218
977569718_977569719 6 Left 977569718 4:98616526-98616548 CCAAGAGGCGCTGGATGGCAAGA 0: 1
1: 0
2: 0
3: 1
4: 118
Right 977569719 4:98616555-98616577 AAGCACAGCCTCCACTCTCAAGG No data
977569718_977569720 7 Left 977569718 4:98616526-98616548 CCAAGAGGCGCTGGATGGCAAGA 0: 1
1: 0
2: 0
3: 1
4: 118
Right 977569720 4:98616556-98616578 AGCACAGCCTCCACTCTCAAGGG 0: 1
1: 0
2: 0
3: 18
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977569718 Original CRISPR TCTTGCCATCCAGCGCCTCT TGG (reversed) Intronic