ID: 977569718 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:98616526-98616548 |
| Sequence | TCTTGCCATCCAGCGCCTCT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 120 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 1, 4: 118} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 977569718_977569720 | 7 | Left | 977569718 | 4:98616526-98616548 | CCAAGAGGCGCTGGATGGCAAGA | 0: 1 1: 0 2: 0 3: 1 4: 118 |
||
| Right | 977569720 | 4:98616556-98616578 | AGCACAGCCTCCACTCTCAAGGG | 0: 1 1: 0 2: 0 3: 18 4: 199 |
||||
| 977569718_977569721 | 8 | Left | 977569718 | 4:98616526-98616548 | CCAAGAGGCGCTGGATGGCAAGA | 0: 1 1: 0 2: 0 3: 1 4: 118 |
||
| Right | 977569721 | 4:98616557-98616579 | GCACAGCCTCCACTCTCAAGGGG | 0: 1 1: 0 2: 0 3: 24 4: 218 |
||||
| 977569718_977569719 | 6 | Left | 977569718 | 4:98616526-98616548 | CCAAGAGGCGCTGGATGGCAAGA | 0: 1 1: 0 2: 0 3: 1 4: 118 |
||
| Right | 977569719 | 4:98616555-98616577 | AAGCACAGCCTCCACTCTCAAGG | 0: 1 1: 1 2: 0 3: 24 4: 277 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 977569718 | Original CRISPR | TCTTGCCATCCAGCGCCTCT TGG (reversed) | Intronic | ||