ID: 977569719

View in Genome Browser
Species Human (GRCh38)
Location 4:98616555-98616577
Sequence AAGCACAGCCTCCACTCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977569718_977569719 6 Left 977569718 4:98616526-98616548 CCAAGAGGCGCTGGATGGCAAGA 0: 1
1: 0
2: 0
3: 1
4: 118
Right 977569719 4:98616555-98616577 AAGCACAGCCTCCACTCTCAAGG No data
977569717_977569719 7 Left 977569717 4:98616525-98616547 CCCAAGAGGCGCTGGATGGCAAG No data
Right 977569719 4:98616555-98616577 AAGCACAGCCTCCACTCTCAAGG No data
977569715_977569719 11 Left 977569715 4:98616521-98616543 CCAGCCCAAGAGGCGCTGGATGG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 977569719 4:98616555-98616577 AAGCACAGCCTCCACTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977569719 Original CRISPR AAGCACAGCCTCCACTCTCA AGG Intronic