ID: 977569720

View in Genome Browser
Species Human (GRCh38)
Location 4:98616556-98616578
Sequence AGCACAGCCTCCACTCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977569717_977569720 8 Left 977569717 4:98616525-98616547 CCCAAGAGGCGCTGGATGGCAAG No data
Right 977569720 4:98616556-98616578 AGCACAGCCTCCACTCTCAAGGG 0: 1
1: 0
2: 0
3: 18
4: 199
977569715_977569720 12 Left 977569715 4:98616521-98616543 CCAGCCCAAGAGGCGCTGGATGG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 977569720 4:98616556-98616578 AGCACAGCCTCCACTCTCAAGGG 0: 1
1: 0
2: 0
3: 18
4: 199
977569718_977569720 7 Left 977569718 4:98616526-98616548 CCAAGAGGCGCTGGATGGCAAGA 0: 1
1: 0
2: 0
3: 1
4: 118
Right 977569720 4:98616556-98616578 AGCACAGCCTCCACTCTCAAGGG 0: 1
1: 0
2: 0
3: 18
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977569720 Original CRISPR AGCACAGCCTCCACTCTCAA GGG Intronic