ID: 977569721

View in Genome Browser
Species Human (GRCh38)
Location 4:98616557-98616579
Sequence GCACAGCCTCCACTCTCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 218}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977569717_977569721 9 Left 977569717 4:98616525-98616547 CCCAAGAGGCGCTGGATGGCAAG No data
Right 977569721 4:98616557-98616579 GCACAGCCTCCACTCTCAAGGGG 0: 1
1: 0
2: 0
3: 24
4: 218
977569718_977569721 8 Left 977569718 4:98616526-98616548 CCAAGAGGCGCTGGATGGCAAGA 0: 1
1: 0
2: 0
3: 1
4: 118
Right 977569721 4:98616557-98616579 GCACAGCCTCCACTCTCAAGGGG 0: 1
1: 0
2: 0
3: 24
4: 218
977569715_977569721 13 Left 977569715 4:98616521-98616543 CCAGCCCAAGAGGCGCTGGATGG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 977569721 4:98616557-98616579 GCACAGCCTCCACTCTCAAGGGG 0: 1
1: 0
2: 0
3: 24
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977569721 Original CRISPR GCACAGCCTCCACTCTCAAG GGG Intronic