ID: 977569721 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:98616557-98616579 |
Sequence | GCACAGCCTCCACTCTCAAG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 243 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 24, 4: 218} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
977569717_977569721 | 9 | Left | 977569717 | 4:98616525-98616547 | CCCAAGAGGCGCTGGATGGCAAG | No data | ||
Right | 977569721 | 4:98616557-98616579 | GCACAGCCTCCACTCTCAAGGGG | 0: 1 1: 0 2: 0 3: 24 4: 218 |
||||
977569718_977569721 | 8 | Left | 977569718 | 4:98616526-98616548 | CCAAGAGGCGCTGGATGGCAAGA | 0: 1 1: 0 2: 0 3: 1 4: 118 |
||
Right | 977569721 | 4:98616557-98616579 | GCACAGCCTCCACTCTCAAGGGG | 0: 1 1: 0 2: 0 3: 24 4: 218 |
||||
977569715_977569721 | 13 | Left | 977569715 | 4:98616521-98616543 | CCAGCCCAAGAGGCGCTGGATGG | 0: 1 1: 0 2: 0 3: 11 4: 126 |
||
Right | 977569721 | 4:98616557-98616579 | GCACAGCCTCCACTCTCAAGGGG | 0: 1 1: 0 2: 0 3: 24 4: 218 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
977569721 | Original CRISPR | GCACAGCCTCCACTCTCAAG GGG | Intronic | ||