ID: 977571831

View in Genome Browser
Species Human (GRCh38)
Location 4:98636984-98637006
Sequence CCTGATGAGCAGTCCTTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977571828_977571831 0 Left 977571828 4:98636961-98636983 CCAGTCTACAGGATACCAAAGCA 0: 1
1: 0
2: 0
3: 5
4: 211
Right 977571831 4:98636984-98637006 CCTGATGAGCAGTCCTTGTCAGG No data
977571824_977571831 22 Left 977571824 4:98636939-98636961 CCCTGGTGTGAGGTTTCTTAGCC 0: 1
1: 0
2: 2
3: 9
4: 120
Right 977571831 4:98636984-98637006 CCTGATGAGCAGTCCTTGTCAGG No data
977571827_977571831 1 Left 977571827 4:98636960-98636982 CCCAGTCTACAGGATACCAAAGC 0: 1
1: 0
2: 1
3: 9
4: 123
Right 977571831 4:98636984-98637006 CCTGATGAGCAGTCCTTGTCAGG No data
977571825_977571831 21 Left 977571825 4:98636940-98636962 CCTGGTGTGAGGTTTCTTAGCCC 0: 1
1: 0
2: 1
3: 10
4: 124
Right 977571831 4:98636984-98637006 CCTGATGAGCAGTCCTTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977571831 Original CRISPR CCTGATGAGCAGTCCTTGTC AGG Intronic
No off target data available for this crispr