ID: 977572706

View in Genome Browser
Species Human (GRCh38)
Location 4:98646136-98646158
Sequence CTTCTCCTCTAGGGCATAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977572706_977572712 22 Left 977572706 4:98646136-98646158 CCCATTATGCCCTAGAGGAGAAG 0: 1
1: 0
2: 0
3: 5
4: 114
Right 977572712 4:98646181-98646203 AGATGATTAGTCAATGATCCAGG 0: 1
1: 0
2: 0
3: 7
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977572706 Original CRISPR CTTCTCCTCTAGGGCATAAT GGG (reversed) Intronic
901588858 1:10322233-10322255 CTTCTCCTCTAGGGTCTGAGAGG + Intronic
907021407 1:51069877-51069899 CTTTTCCTCTATGACATAAATGG + Intergenic
907704960 1:56825013-56825035 CTTCTGCTCTAGGAGACAATGGG - Intergenic
907735668 1:57109262-57109284 CTTCTCCTCTAGTTCATGTTGGG + Intronic
909018920 1:70410090-70410112 CCACTCCTCTAGTGCTTAATGGG + Intergenic
909589294 1:77328031-77328053 CTTCACTTCTAGCTCATAATAGG + Intronic
912484126 1:110011053-110011075 CTGCTCCTCTAGGTTCTAATAGG - Intronic
921374719 1:214461858-214461880 CTTCTCCTCTAAAGCAGCATCGG + Intronic
1063532838 10:6852364-6852386 CTTCTCCTCTGGTGAATATTAGG - Intergenic
1066505646 10:36039593-36039615 CTTCTCTTCTTGTGCATAAGGGG + Intergenic
1069304927 10:66957501-66957523 CTTGTACTCTTGGGCATAGTGGG + Intronic
1071562624 10:86655675-86655697 CTTCTCCTCTAAGGCTCAGTAGG + Intronic
1073473838 10:103740194-103740216 CATCTCCTCTAGGACAAAATGGG - Intronic
1075879533 10:125838830-125838852 CTTCCCCTCAAGGGAATAAAGGG - Intronic
1082124722 11:48418728-48418750 CATCTCCTCTAGGGAAAAGTTGG + Intergenic
1082251332 11:49984039-49984061 CATCTCCTCTAGGGAAAAGTTGG - Intergenic
1084297363 11:68221707-68221729 GTTTTCCTCTAGGGCATTCTGGG + Intergenic
1086386569 11:86314974-86314996 CTTCTGCTCTAGGGCATTCATGG + Intronic
1086434115 11:86764484-86764506 CTTCTCCTGTCAGGCATAGTGGG - Intergenic
1086445541 11:86867036-86867058 CTCTTTCTCTAGGGCACAATGGG - Intronic
1086968318 11:93053183-93053205 CTTGTCCTGTATGGTATAATTGG - Intergenic
1089618995 11:119711852-119711874 CTTGTCCTCCAGGGAATATTCGG + Intronic
1095313738 12:40732557-40732579 TTTCTCCTCTAGTGCATAGAGGG + Intronic
1103079569 12:118012794-118012816 CTCCACCTCTAGGGCACAAGTGG - Intergenic
1104332908 12:127864189-127864211 ATTCTCCTCTTGGTCATGATTGG - Intergenic
1104464489 12:128979369-128979391 ATTCTCCTCTAGGGCACGGTTGG + Intronic
1104838141 12:131805457-131805479 GTTCTCTTCTGGGGCATATTTGG + Intergenic
1105071924 12:133239523-133239545 TTTCTCCTCTTTGGCATAATGGG + Intergenic
1105417073 13:20222764-20222786 ACTCTCCTTTAGGGCATGATTGG + Exonic
1106189803 13:27441697-27441719 CATCTCATCTAGGGCATGCTAGG + Intronic
1107585490 13:41842918-41842940 CTGCTCTTCTAGGGCATCAATGG + Intronic
1108309017 13:49167229-49167251 CTTCTCCTCTGGGGAAAAAAGGG - Exonic
1110846923 13:80200537-80200559 CTTCTCCTCGAGAGCAAAATAGG - Intergenic
1115289935 14:31758923-31758945 CTTTTCCTCCATGGCACAATAGG + Intronic
1115923518 14:38405382-38405404 ATTCACCTCTAGCTCATAATAGG + Intergenic
1120101990 14:80455334-80455356 CTACTCCTCTAGGTCATTAAAGG - Intergenic
1133621542 16:7531445-7531467 TTTCTCATCTAGGCCATAAGGGG - Intronic
1134468715 16:14502354-14502376 TTTCTCCTCTAGGACATCAGAGG + Intronic
1142167513 16:88600379-88600401 CTTCTCCTCCAGGGCATTGATGG + Intronic
1142226001 16:88877916-88877938 CTTCTCCCCTAGGGCAGGTTTGG - Intronic
1157439045 18:47696343-47696365 CCTCTCCTCTTGGGAATATTGGG + Intergenic
1158341762 18:56473640-56473662 CTTCTTCTCCAGGCCATCATTGG + Intergenic
1158507663 18:58060731-58060753 CTTCTCCCCTAGGGGACATTTGG + Intronic
1159697619 18:71580168-71580190 CTTCTTCCCTAGGAAATAATAGG + Intergenic
1163850381 19:19659717-19659739 CTTCTTCTCCAGGGCATCGTAGG + Exonic
930365877 2:50438758-50438780 CTTCTCCCCAGGGGCATATTTGG + Intronic
935460946 2:103333266-103333288 CTTCCTCTCTAGGACATAAGAGG + Intergenic
937536162 2:122890248-122890270 CTCCTCCTCTAGCGCATGCTAGG - Intergenic
943267680 2:185756097-185756119 CAGCTCCTCTTGGGCATAAAAGG + Intronic
944358902 2:198828059-198828081 CTTCTTCTCTATGGCTCAATTGG + Intergenic
945613657 2:212038860-212038882 CATCTTCTCTAGGGCATGATCGG + Intronic
946314119 2:218898181-218898203 CTTCCCCTGTAGGGCAGAAGAGG - Intronic
1173217665 20:41101226-41101248 CTCCTCCTCCAGGACATAAGTGG + Exonic
1177225198 21:18244940-18244962 CTTCGCCTCTAGGACATACACGG + Exonic
1177548408 21:22589930-22589952 CTTCTCCTGTGTGTCATAATAGG - Intergenic
1179631877 21:42683873-42683895 CTTCTCCTCCTGGGCACAAAGGG - Intronic
1181363152 22:22354228-22354250 CTTCTCCTCTATTGCACCATTGG + Intergenic
1182168221 22:28198319-28198341 CTTTTCCTCTGGGGCACATTTGG - Intronic
951131911 3:19056662-19056684 CTTCTCCTCTAGGAGAGGATGGG + Intergenic
952642727 3:35616987-35617009 CTTCTCCTCTTGGTCACAAATGG - Intergenic
953564371 3:44018548-44018570 GTGCTCCTATAGGGCCTAATAGG + Intergenic
956320061 3:67986539-67986561 CTTCTCTTTCAGGGCATCATGGG + Intergenic
956768876 3:72507549-72507571 CTTCACCCCTAGGGCATCTTTGG - Intergenic
957152965 3:76510103-76510125 GTTCTCATGTAGGGCATCATAGG - Intronic
966906783 3:184531983-184532005 CTTCTCCCCCAGCGCATACTGGG - Intronic
969095539 4:4729665-4729687 TTGCTCCTCATGGGCATAATAGG - Intergenic
970465924 4:16323047-16323069 CTTCTATTCGTGGGCATAATGGG + Intergenic
971174717 4:24271196-24271218 CTACTGCTCTAGTGCATCATGGG + Intergenic
972181824 4:36476002-36476024 CTTATTCTCTAGGGCATTCTAGG + Intergenic
977429329 4:96911757-96911779 CTTCTTCACTGGGGCATAAAAGG + Intergenic
977572706 4:98646136-98646158 CTTCTCCTCTAGGGCATAATGGG - Intronic
980705816 4:136492315-136492337 CTTTCCCTCTTGTGCATAATTGG - Intergenic
984369228 4:178840477-178840499 CTTCTCCTTTTGTTCATAATAGG - Intergenic
984614142 4:181876881-181876903 TTTCTCCTTTAGGAAATAATTGG + Intergenic
994397025 5:99233612-99233634 CTTCTCCCCTACTGCATATTCGG - Intergenic
994782676 5:104112594-104112616 ATTCTACTCCAGGCCATAATAGG + Intergenic
996836174 5:127795203-127795225 CTTCGCCTCTGGGGCTTAAGGGG - Intergenic
996969540 5:129347154-129347176 CTTCTTTTCTAGTGTATAATTGG + Intergenic
999369173 5:151042775-151042797 CTTCTCCTCTGGGCCATACTGGG + Intronic
999873439 5:155775852-155775874 CTTCTCCTTTGGAGCAGAATTGG - Intergenic
1003039098 6:2670582-2670604 CTTCTCCTTTAGGGCTACATTGG + Intronic
1007854177 6:44837398-44837420 CTTTTCCTCTGGGCAATAATGGG + Intronic
1010064977 6:71672024-71672046 CCTCTCCTCTAGGACATCAACGG - Intergenic
1013018504 6:106184570-106184592 CTCTTCCTCTAGGGCATTGTAGG + Exonic
1015869806 6:137764790-137764812 CTTCTTCTCAAAGGCTTAATGGG - Intergenic
1016705973 6:147108527-147108549 CTTCTCCTCCATGTCATCATAGG - Intergenic
1019608944 7:1926343-1926365 AATCTCCTCTAGGACATAAAAGG + Intronic
1024525642 7:50346717-50346739 CTTCCCCCTCAGGGCATAATGGG + Intronic
1024734507 7:52289958-52289980 CTTGTACTCTACTGCATAATAGG - Intergenic
1025793040 7:64710227-64710249 GTTTTCCTCTAGTGCAAAATGGG - Exonic
1026154823 7:67817782-67817804 CTTCTTATCTAGGGCCTGATGGG + Intergenic
1026307318 7:69153310-69153332 GTTCTCACCTAGGGCATGATGGG - Intergenic
1028000974 7:85498444-85498466 CTCCTCCTCTAGCACATAACTGG - Intergenic
1028193107 7:87875480-87875502 CCTCTACTCCAGGCCATAATAGG - Intronic
1028520483 7:91724848-91724870 CTTCTCAGCTAGGTCATTATTGG - Intronic
1032785769 7:135198141-135198163 CTTTTCCTCTAGGGCACCAAGGG - Exonic
1037288306 8:17324157-17324179 TTTCTGCTCTAGGTCAAAATTGG + Intronic
1037424900 8:18745039-18745061 CTTCTCCTTTAGAGCATCAGAGG + Intronic
1037553345 8:19996728-19996750 CTTTTCCTCTAGGGAACAAGTGG - Intergenic
1038134701 8:24772716-24772738 CTTTTCCTTTAGGCCATAACTGG + Intergenic
1041988658 8:63957386-63957408 CTTCTCCACTAAGAAATAATAGG + Intergenic
1042927040 8:73976759-73976781 CTTCTACTCAAGGGCAGAAAAGG - Intronic
1044528200 8:93276197-93276219 CTTTTCCTCCAATGCATAATAGG - Intergenic
1045821818 8:106347215-106347237 TTTCTTCTTTAGGGCATTATTGG - Intronic
1047427763 8:124762091-124762113 CTTCTCCTTTTGGGCTTATTTGG + Intergenic
1049861820 8:144903816-144903838 CTTCTCCTATAGGGCAACAAAGG + Intergenic
1052662547 9:31453982-31454004 CTTTGCCTTTAGGGCTTAATAGG + Intergenic
1054769106 9:69067957-69067979 CTTAGCCTCTAGTGTATAATGGG + Intronic
1056451600 9:86722200-86722222 TTTCTCCTCTGGGGAATAAGCGG + Intergenic
1056706234 9:88954694-88954716 CTTCTTTTCTTGGGCTTAATTGG - Intergenic
1057878107 9:98772920-98772942 CACCTCTTCTAGGGCAGAATGGG + Intronic
1057912472 9:99030878-99030900 CTGCTCCTCTTGGGTATGATTGG - Intronic
1061441216 9:130605169-130605191 CTTCTCCTCAAGAGCCTAAGAGG - Intronic
1188244450 X:27823329-27823351 CTTGTCCTCTAGGACTTAGTGGG - Intergenic
1190452890 X:50598434-50598456 CTCCTCCCCAAGGGCAGAATTGG + Exonic
1193080198 X:77399129-77399151 AATCTCCTCAAGGGCATAAAGGG - Intergenic
1193211805 X:78815575-78815597 CTTCTACTCTTGGTGATAATTGG - Intergenic
1197433357 X:126394387-126394409 CTTCTACTCTGGGGCTTAAGGGG - Intergenic
1198463435 X:136884279-136884301 CCTCTAGTCTAGGGCAAAATGGG + Intergenic
1200208466 X:154334529-154334551 GTTCTCCTCTCGGGCCTGATCGG - Intergenic