ID: 977574090

View in Genome Browser
Species Human (GRCh38)
Location 4:98658739-98658761
Sequence GCGCGCGCGCGCACGGGGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 203}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977574071_977574090 24 Left 977574071 4:98658692-98658714 CCGCCCGCGCCGCCCGCAGCTCC 0: 1
1: 0
2: 9
3: 119
4: 1112
Right 977574090 4:98658739-98658761 GCGCGCGCGCGCACGGGGTCGGG 0: 1
1: 0
2: 4
3: 24
4: 203
977574078_977574090 3 Left 977574078 4:98658713-98658735 CCGCCCGCCGCCCAAGCCTTGGC 0: 1
1: 0
2: 0
3: 23
4: 303
Right 977574090 4:98658739-98658761 GCGCGCGCGCGCACGGGGTCGGG 0: 1
1: 0
2: 4
3: 24
4: 203
977574083_977574090 -7 Left 977574083 4:98658723-98658745 CCCAAGCCTTGGCTAGGCGCGCG 0: 1
1: 0
2: 0
3: 1
4: 25
Right 977574090 4:98658739-98658761 GCGCGCGCGCGCACGGGGTCGGG 0: 1
1: 0
2: 4
3: 24
4: 203
977574074_977574090 15 Left 977574074 4:98658701-98658723 CCGCCCGCAGCTCCGCCCGCCGC 0: 1
1: 0
2: 8
3: 88
4: 757
Right 977574090 4:98658739-98658761 GCGCGCGCGCGCACGGGGTCGGG 0: 1
1: 0
2: 4
3: 24
4: 203
977574073_977574090 20 Left 977574073 4:98658696-98658718 CCGCGCCGCCCGCAGCTCCGCCC 0: 1
1: 0
2: 13
3: 112
4: 816
Right 977574090 4:98658739-98658761 GCGCGCGCGCGCACGGGGTCGGG 0: 1
1: 0
2: 4
3: 24
4: 203
977574072_977574090 21 Left 977574072 4:98658695-98658717 CCCGCGCCGCCCGCAGCTCCGCC 0: 1
1: 0
2: 7
3: 131
4: 893
Right 977574090 4:98658739-98658761 GCGCGCGCGCGCACGGGGTCGGG 0: 1
1: 0
2: 4
3: 24
4: 203
977574075_977574090 12 Left 977574075 4:98658704-98658726 CCCGCAGCTCCGCCCGCCGCCCA 0: 1
1: 0
2: 5
3: 48
4: 484
Right 977574090 4:98658739-98658761 GCGCGCGCGCGCACGGGGTCGGG 0: 1
1: 0
2: 4
3: 24
4: 203
977574080_977574090 -1 Left 977574080 4:98658717-98658739 CCGCCGCCCAAGCCTTGGCTAGG 0: 1
1: 0
2: 0
3: 10
4: 111
Right 977574090 4:98658739-98658761 GCGCGCGCGCGCACGGGGTCGGG 0: 1
1: 0
2: 4
3: 24
4: 203
977574070_977574090 27 Left 977574070 4:98658689-98658711 CCTCCGCCCGCGCCGCCCGCAGC 0: 1
1: 1
2: 25
3: 178
4: 1216
Right 977574090 4:98658739-98658761 GCGCGCGCGCGCACGGGGTCGGG 0: 1
1: 0
2: 4
3: 24
4: 203
977574084_977574090 -8 Left 977574084 4:98658724-98658746 CCAAGCCTTGGCTAGGCGCGCGC 0: 1
1: 0
2: 0
3: 2
4: 34
Right 977574090 4:98658739-98658761 GCGCGCGCGCGCACGGGGTCGGG 0: 1
1: 0
2: 4
3: 24
4: 203
977574076_977574090 11 Left 977574076 4:98658705-98658727 CCGCAGCTCCGCCCGCCGCCCAA 0: 1
1: 0
2: 2
3: 25
4: 329
Right 977574090 4:98658739-98658761 GCGCGCGCGCGCACGGGGTCGGG 0: 1
1: 0
2: 4
3: 24
4: 203
977574082_977574090 -4 Left 977574082 4:98658720-98658742 CCGCCCAAGCCTTGGCTAGGCGC 0: 1
1: 0
2: 0
3: 5
4: 94
Right 977574090 4:98658739-98658761 GCGCGCGCGCGCACGGGGTCGGG 0: 1
1: 0
2: 4
3: 24
4: 203
977574079_977574090 0 Left 977574079 4:98658716-98658738 CCCGCCGCCCAAGCCTTGGCTAG 0: 1
1: 0
2: 0
3: 8
4: 130
Right 977574090 4:98658739-98658761 GCGCGCGCGCGCACGGGGTCGGG 0: 1
1: 0
2: 4
3: 24
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977574090 Original CRISPR GCGCGCGCGCGCACGGGGTC GGG Intergenic