ID: 977574754

View in Genome Browser
Species Human (GRCh38)
Location 4:98663891-98663913
Sequence CATCCTCTGCAGAAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977574745_977574754 29 Left 977574745 4:98663839-98663861 CCGAAAGCTGGGGGTGGGTCCGC No data
Right 977574754 4:98663891-98663913 CATCCTCTGCAGAAAGAGGAAGG No data
977574748_977574754 10 Left 977574748 4:98663858-98663880 CCGCATTTCCAGGAGGAAGCCAA No data
Right 977574754 4:98663891-98663913 CATCCTCTGCAGAAAGAGGAAGG No data
977574749_977574754 2 Left 977574749 4:98663866-98663888 CCAGGAGGAAGCCAAGACTCTCC No data
Right 977574754 4:98663891-98663913 CATCCTCTGCAGAAAGAGGAAGG No data
977574744_977574754 30 Left 977574744 4:98663838-98663860 CCCGAAAGCTGGGGGTGGGTCCG No data
Right 977574754 4:98663891-98663913 CATCCTCTGCAGAAAGAGGAAGG No data
977574750_977574754 -9 Left 977574750 4:98663877-98663899 CCAAGACTCTCCCTCATCCTCTG No data
Right 977574754 4:98663891-98663913 CATCCTCTGCAGAAAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977574754 Original CRISPR CATCCTCTGCAGAAAGAGGA AGG Intergenic
No off target data available for this crispr