ID: 977574989

View in Genome Browser
Species Human (GRCh38)
Location 4:98665821-98665843
Sequence GTGAGCTATCTGGGCAACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977574981_977574989 30 Left 977574981 4:98665768-98665790 CCAGGGGACTCGTCGCACTTGCA No data
Right 977574989 4:98665821-98665843 GTGAGCTATCTGGGCAACTTGGG No data
977574982_977574989 3 Left 977574982 4:98665795-98665817 CCGAGAACATAGCACCTCCCAGT No data
Right 977574989 4:98665821-98665843 GTGAGCTATCTGGGCAACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977574989 Original CRISPR GTGAGCTATCTGGGCAACTT GGG Intergenic
No off target data available for this crispr