ID: 977577690

View in Genome Browser
Species Human (GRCh38)
Location 4:98692207-98692229
Sequence GTGGAATAAGTATGAAATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977577690_977577697 18 Left 977577690 4:98692207-98692229 CCAGTATTTCATACTTATTCCAC No data
Right 977577697 4:98692248-98692270 GTAAATTCTCAGTATTGTTAGGG No data
977577690_977577696 17 Left 977577690 4:98692207-98692229 CCAGTATTTCATACTTATTCCAC No data
Right 977577696 4:98692247-98692269 AGTAAATTCTCAGTATTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977577690 Original CRISPR GTGGAATAAGTATGAAATAC TGG (reversed) Intergenic
No off target data available for this crispr