ID: 977583079

View in Genome Browser
Species Human (GRCh38)
Location 4:98746155-98746177
Sequence GGACTAATATGGCAATTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977583079_977583082 1 Left 977583079 4:98746155-98746177 CCTGGAAATTGCCATATTAGTCC No data
Right 977583082 4:98746179-98746201 TGTCTTGATCTAATATTGCATGG No data
977583079_977583084 18 Left 977583079 4:98746155-98746177 CCTGGAAATTGCCATATTAGTCC No data
Right 977583084 4:98746196-98746218 GCATGGACAGAATTTCACATGGG No data
977583079_977583083 17 Left 977583079 4:98746155-98746177 CCTGGAAATTGCCATATTAGTCC No data
Right 977583083 4:98746195-98746217 TGCATGGACAGAATTTCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977583079 Original CRISPR GGACTAATATGGCAATTTCC AGG (reversed) Intergenic
No off target data available for this crispr