ID: 977583080

View in Genome Browser
Species Human (GRCh38)
Location 4:98746166-98746188
Sequence GATCAAGACATGGACTAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977583080_977583083 6 Left 977583080 4:98746166-98746188 CCATATTAGTCCATGTCTTGATC No data
Right 977583083 4:98746195-98746217 TGCATGGACAGAATTTCACATGG No data
977583080_977583082 -10 Left 977583080 4:98746166-98746188 CCATATTAGTCCATGTCTTGATC No data
Right 977583082 4:98746179-98746201 TGTCTTGATCTAATATTGCATGG No data
977583080_977583084 7 Left 977583080 4:98746166-98746188 CCATATTAGTCCATGTCTTGATC No data
Right 977583084 4:98746196-98746218 GCATGGACAGAATTTCACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977583080 Original CRISPR GATCAAGACATGGACTAATA TGG (reversed) Intergenic
No off target data available for this crispr