ID: 977583081

View in Genome Browser
Species Human (GRCh38)
Location 4:98746176-98746198
Sequence TGCAATATTAGATCAAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977583081_977583083 -4 Left 977583081 4:98746176-98746198 CCATGTCTTGATCTAATATTGCA No data
Right 977583083 4:98746195-98746217 TGCATGGACAGAATTTCACATGG No data
977583081_977583084 -3 Left 977583081 4:98746176-98746198 CCATGTCTTGATCTAATATTGCA No data
Right 977583084 4:98746196-98746218 GCATGGACAGAATTTCACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977583081 Original CRISPR TGCAATATTAGATCAAGACA TGG (reversed) Intergenic
No off target data available for this crispr