ID: 977583084

View in Genome Browser
Species Human (GRCh38)
Location 4:98746196-98746218
Sequence GCATGGACAGAATTTCACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977583079_977583084 18 Left 977583079 4:98746155-98746177 CCTGGAAATTGCCATATTAGTCC No data
Right 977583084 4:98746196-98746218 GCATGGACAGAATTTCACATGGG No data
977583080_977583084 7 Left 977583080 4:98746166-98746188 CCATATTAGTCCATGTCTTGATC No data
Right 977583084 4:98746196-98746218 GCATGGACAGAATTTCACATGGG No data
977583081_977583084 -3 Left 977583081 4:98746176-98746198 CCATGTCTTGATCTAATATTGCA No data
Right 977583084 4:98746196-98746218 GCATGGACAGAATTTCACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977583084 Original CRISPR GCATGGACAGAATTTCACAT GGG Intergenic
No off target data available for this crispr