ID: 977583173

View in Genome Browser
Species Human (GRCh38)
Location 4:98746914-98746936
Sequence CAGTGGATAGGGAGGTGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977583173_977583179 24 Left 977583173 4:98746914-98746936 CCTTTTCACCTCCCTATCCACTG No data
Right 977583179 4:98746961-98746983 AAAAGAGCCATCCAGTCAGTAGG No data
977583173_977583180 25 Left 977583173 4:98746914-98746936 CCTTTTCACCTCCCTATCCACTG No data
Right 977583180 4:98746962-98746984 AAAGAGCCATCCAGTCAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977583173 Original CRISPR CAGTGGATAGGGAGGTGAAA AGG (reversed) Intergenic
No off target data available for this crispr