ID: 977592031

View in Genome Browser
Species Human (GRCh38)
Location 4:98837474-98837496
Sequence CAAATTAGACAGTATGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977592030_977592031 -1 Left 977592030 4:98837452-98837474 CCTCTCTGAGAATCAAGTTTTAC No data
Right 977592031 4:98837474-98837496 CAAATTAGACAGTATGAACTTGG No data
977592029_977592031 0 Left 977592029 4:98837451-98837473 CCCTCTCTGAGAATCAAGTTTTA No data
Right 977592031 4:98837474-98837496 CAAATTAGACAGTATGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977592031 Original CRISPR CAAATTAGACAGTATGAACT TGG Intergenic
No off target data available for this crispr