ID: 977594607

View in Genome Browser
Species Human (GRCh38)
Location 4:98865153-98865175
Sequence TCTCTGAGATTTGCCACCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977594607 Original CRISPR TCTCTGAGATTTGCCACCAG TGG (reversed) Intergenic