ID: 977595217

View in Genome Browser
Species Human (GRCh38)
Location 4:98871992-98872014
Sequence CTGCCTAAGTGGAAGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 1, 2: 3, 3: 26, 4: 202}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977595217 Original CRISPR CTGCCTAAGTGGAAGGTGAA AGG Intronic
903538112 1:24080848-24080870 CTTCCTCAGTGGGAGGTGAGGGG + Intronic
904981051 1:34502085-34502107 GTGCCTGAGGGGAAGGAGAAGGG - Intergenic
905824178 1:41016656-41016678 CTGCCCAAGTAGAGGGTGAGGGG + Intronic
906126591 1:43430836-43430858 CTGCCTAAGTGGGAGTGGAGGGG + Intronic
909237204 1:73168016-73168038 CTGGCTAAGAGCAAGTTGAATGG + Intergenic
911679266 1:100695479-100695501 CTGTCTAAGTGGAAGATGCATGG + Intergenic
914394910 1:147256327-147256349 CTGATTAAGTGGAAGGTCAGTGG - Intronic
916515233 1:165510460-165510482 ATGCCTAATTGGAATGTGCAAGG - Intergenic
917839279 1:178964349-178964371 CTTCCTAAGGGGAGTGTGAAGGG + Intergenic
918030436 1:180802680-180802702 TGGGCTGAGTGGAAGGTGAATGG - Intronic
920398183 1:205661274-205661296 CTGCCACAGGGGAAGGGGAAGGG + Intronic
920519736 1:206614381-206614403 GTGGCTAAGTGGGAGGTGAAGGG - Intergenic
921354617 1:214274475-214274497 CTGACTAAGTGGGAAGTTAACGG + Intergenic
924404338 1:243726922-243726944 CTGCCTAAGTAGAAGGTGATTGG - Intronic
1063077545 10:2732028-2732050 CTGCCCAAGTGCAAGTTGACTGG + Intergenic
1063477425 10:6341046-6341068 CTGCTCAGGTGGAGGGTGAAGGG + Intergenic
1067825472 10:49569308-49569330 CTGCCTCAGTGCAAGGAGACAGG - Intergenic
1067836264 10:49643712-49643734 CTGGCTAATGGGAAGGGGAAAGG - Intronic
1069775433 10:70924468-70924490 CTGCCTGGGTTGAAGGTGGATGG - Intergenic
1070641830 10:78175868-78175890 CAGTCACAGTGGAAGGTGAAGGG - Intergenic
1071922125 10:90362275-90362297 CTGCCTAACTGCAAGGTGACTGG - Intergenic
1073608494 10:104919895-104919917 TTGCCTAAGTGGCTGGAGAAGGG - Intronic
1073838250 10:107469268-107469290 CTGCCCTAATGGAAGATGAATGG + Intergenic
1073920760 10:108455769-108455791 CTTCCTAAGGGAAAAGTGAAAGG - Intergenic
1074317633 10:112373868-112373890 CTACCTCAGGGGAAGGAGAAGGG - Intergenic
1074556896 10:114499756-114499778 CTGCTTACGTGGCAGGTGCATGG + Intronic
1076312160 10:129516339-129516361 CTGCCTCAGTGAAACGTGCATGG + Intronic
1076454233 10:130578342-130578364 CTGCCTAGGTGGAGGGTGAGTGG - Intergenic
1078006080 11:7533352-7533374 GTACCTGAGTGGAAAGTGAAGGG - Intronic
1078737839 11:14036978-14037000 ATGAATAAGTGGGAGGTGAAGGG + Intronic
1079966711 11:26988995-26989017 CTGCCTCAGTGCAAAGAGAAAGG - Intergenic
1079984573 11:27187203-27187225 CTGCCTACTTGTAAGGAGAAAGG + Intergenic
1080670948 11:34377207-34377229 CTCCCAAAGTGGAAGGTTACAGG + Intergenic
1081462592 11:43285795-43285817 CTGCATAAGAGGCAGTTGAAGGG - Intergenic
1081792937 11:45801829-45801851 GTGACTTAGTGGATGGTGAAGGG - Intergenic
1083178988 11:60972258-60972280 CTGCCTCTCTGGAAGGTGAACGG - Intronic
1083429660 11:62607636-62607658 ATGGATAAGTGGAAGGTGATGGG - Intronic
1085370394 11:75998462-75998484 CTGCCTAAGATGTAGGTGAAAGG + Intronic
1090265952 11:125353055-125353077 CTGGCTGAGTGGAATGGGAATGG - Intronic
1091690247 12:2591337-2591359 CTGTATAAGATGAAGGTGAAGGG - Intronic
1093587271 12:20854660-20854682 CTGGCTAACTGGGAGGGGAATGG - Intronic
1094295153 12:28897512-28897534 CAGTTGAAGTGGAAGGTGAAAGG - Intergenic
1095585066 12:43840517-43840539 TTGCCTTAGCGGAAGTTGAATGG + Intronic
1095662282 12:44751185-44751207 CAGACTAAGTGGAAGGGGGAAGG + Intronic
1096869156 12:54582783-54582805 TTGCCAAAGTGGACTGTGAAGGG + Exonic
1097210824 12:57368291-57368313 CTAACTAAGAGGAAGGGGAAGGG - Intronic
1097787934 12:63781317-63781339 TTGTCTAATTGGAAGGAGAAAGG - Intronic
1097974764 12:65672588-65672610 CTGCGTAAGTGAAAGGACAATGG + Intergenic
1099760179 12:86911438-86911460 CTGTCAGGGTGGAAGGTGAAGGG - Intergenic
1101478119 12:105070744-105070766 CTTCCTAAATGGAGGGTCAAGGG - Exonic
1102414533 12:112749053-112749075 TTGCCTACCTGGAAGCTGAAAGG + Intronic
1105005258 12:132717424-132717446 CTCCCGACCTGGAAGGTGAAAGG - Exonic
1105411389 13:20174474-20174496 TTGCTTAAGTGGAATGGGAAGGG + Intergenic
1108135523 13:47353546-47353568 CAGCCTCAGTGTAAGGTGAATGG + Intergenic
1111101960 13:83599764-83599786 CTGCCTGAGTGTAAGGGCAATGG + Intergenic
1115556231 14:34546875-34546897 CTGCCTTACTGGAAGTTGAAAGG + Intergenic
1115557677 14:34556206-34556228 CTGCCTTACTGGAAGTTGAAAGG - Intergenic
1116409760 14:44607549-44607571 CTGCCTAAGGGAAAGCTTAATGG + Intergenic
1116512459 14:45763668-45763690 GTGCATATGTGGAGGGTGAAGGG + Intergenic
1116720425 14:48488842-48488864 CTGAATAAGTGAAAGGTGAAGGG + Intergenic
1117539105 14:56729447-56729469 TTCCCAAAGTGGAAGGAGAAGGG + Intronic
1118723412 14:68609751-68609773 CTGGAGAAGAGGAAGGTGAAAGG - Intronic
1119505649 14:75170904-75170926 ATTCCTAAGTGAAAGGTTAATGG + Intronic
1119882984 14:78116224-78116246 CTGCCTAATTTGAAGGTGGAGGG - Intergenic
1120690126 14:87583129-87583151 GTGCCTAAGTGCAGGGAGAAGGG - Intergenic
1121253731 14:92516951-92516973 AGGCCTAAGGGGATGGTGAAGGG - Intronic
1121258996 14:92552755-92552777 CTGCCAAAGAGGAAGAGGAAAGG - Intronic
1122335587 14:100977522-100977544 GTGACTAAATGAAAGGTGAAAGG + Intergenic
1122850156 14:104523678-104523700 CAGTCACAGTGGAAGGTGAAGGG + Intronic
1124215497 15:27804931-27804953 CTGCCATAGTGGGAGGAGAACGG - Intronic
1125452067 15:39819305-39819327 AAGCCTAAGTGCAATGTGAATGG - Intronic
1126474374 15:49050845-49050867 CAACCACAGTGGAAGGTGAAAGG + Intergenic
1126964642 15:54037739-54037761 GTCCCTAAGTGCAAAGTGAATGG - Intronic
1127524336 15:59777297-59777319 CTGCCTAAGTGGAAGGAGAATGG - Intergenic
1129903465 15:79169570-79169592 TTCCCTAAGTGTAAGGTGAGGGG + Intergenic
1129910801 15:79224553-79224575 CTGCCAAAGGGGAAGCAGAATGG - Intergenic
1131096801 15:89660715-89660737 CTCCCCTAGTGGAAGGGGAAAGG - Intergenic
1131408716 15:92188013-92188035 CTGCCTGAGTGAAAGGAGAATGG - Intergenic
1131552950 15:93373491-93373513 GTTCCTAAGTGGAAGAGGAAAGG - Intergenic
1134327545 16:13220847-13220869 CTGCCTAAGTGAAGAGAGAAAGG + Intronic
1137272685 16:46912680-46912702 CAGTCAAAGCGGAAGGTGAAGGG + Intronic
1140051398 16:71484483-71484505 CTGCCTCAGTGGAGGGAGACAGG - Intronic
1140197448 16:72866830-72866852 GTGCCTGTGTGGATGGTGAATGG - Intronic
1141977121 16:87524371-87524393 CTGCCTAGATGGAAGGAGAGTGG + Intergenic
1142507450 17:373911-373933 CTTCCATAGTGGAAGGTGATGGG - Intronic
1142782213 17:2190125-2190147 CTGCCTATGGGGAGGGTGAAGGG - Intronic
1147761054 17:42797734-42797756 CTGCGTCCCTGGAAGGTGAAGGG + Exonic
1150636257 17:66915315-66915337 CTGCAGAAGTGGGAGGTGGAAGG + Intergenic
1150796169 17:68239077-68239099 CAGCTTCAGTGGAAGTTGAACGG - Intergenic
1151988346 17:77558168-77558190 CTCCCCAGGTGGAAGGTGAGGGG + Intergenic
1156130061 18:33961839-33961861 TTGCCAAAGTAGAAGGAGAAAGG + Intronic
1156365187 18:36419667-36419689 GTGCCTAAGTAGTGGGTGAATGG + Intronic
1157567095 18:48686664-48686686 CTGGCTATGTGGAAAGGGAAGGG + Intronic
1157903538 18:51544173-51544195 CTGCCAAAGTGTAAAGTTAATGG + Intergenic
1159685728 18:71417598-71417620 CTGCCTAAGTGGAGAGTGAAGGG + Intergenic
1160257584 18:77260261-77260283 CTCACAGAGTGGAAGGTGAAAGG + Intronic
1164575376 19:29402630-29402652 GTGCCTAAGTGGAGGGGGAGGGG - Intergenic
1166298037 19:41898130-41898152 CTGCCTTAGTGGATGGGGGAAGG - Intronic
1166318056 19:41999537-41999559 GAGCTTAGGTGGAAGGTGAAGGG - Intronic
925457293 2:4027030-4027052 CTGGCTGAGTGGAAGCTGGAGGG + Intergenic
926254107 2:11175237-11175259 CTGCTTAAGTGGAAGTTCCATGG - Intronic
929340293 2:40807511-40807533 CTGCCTAAGAGGAAGTTGAAAGG - Intergenic
930152225 2:48070381-48070403 GTGCCTACTGGGAAGGTGAATGG - Intergenic
931218894 2:60271304-60271326 CTGGGTATGTGGATGGTGAATGG - Intergenic
931838977 2:66128894-66128916 TTTCCTCAGTGGAAGATGAAAGG - Intergenic
932400924 2:71480819-71480841 CTAACTCAGCGGAAGGTGAAAGG + Intronic
932903926 2:75729685-75729707 CAACCATAGTGGAAGGTGAAGGG - Intergenic
933003354 2:76955728-76955750 CTCCCCAAGTGGAGAGTGAAAGG - Intronic
935594867 2:104870500-104870522 CTACCTAGGAGGAAGGTGAAGGG + Intergenic
935923828 2:108045072-108045094 CTGCATATCTGGAAGGTCAAAGG - Intergenic
936261193 2:110960618-110960640 CTCCCAAGGTGGAAGGTAAATGG - Intronic
936434818 2:112495392-112495414 CTGCCTATGAGGAAGGTACAAGG - Intronic
939673458 2:145042542-145042564 CTGCCTAAGAAGAAGATAAAAGG + Intergenic
940130940 2:150381004-150381026 CTGGCTAAGTGGAAGATAGATGG - Intergenic
940156362 2:150660975-150660997 CAGTCACAGTGGAAGGTGAAAGG - Intergenic
945777451 2:214124860-214124882 CAGCCCAAGGGCAAGGTGAAAGG - Intronic
946168724 2:217881011-217881033 ATGCCTAAGTGGGATGGGAAAGG + Exonic
946408746 2:219506231-219506253 CTGCCAAAGAGGACAGTGAAAGG - Intronic
946927234 2:224637778-224637800 CATCCTATCTGGAAGGTGAAGGG + Intergenic
948064760 2:235069290-235069312 CAGCCATGGTGGAAGGTGAAAGG + Intergenic
948079000 2:235190130-235190152 CAGTCATAGTGGAAGGTGAAGGG - Intergenic
948214926 2:236221571-236221593 CTGGGGAGGTGGAAGGTGAAAGG - Intronic
948291962 2:236832300-236832322 CTGCCCAAGTGGGCTGTGAAGGG + Intergenic
948387192 2:237588267-237588289 ATCCCACAGTGGAAGGTGAAAGG - Intronic
1170462065 20:16586677-16586699 CAGCCAAAGGAGAAGGTGAAGGG + Intergenic
1171089812 20:22273797-22273819 CTGCCTAAGTGATGGATGAATGG - Intergenic
1171186505 20:23127404-23127426 CTGCCTGAGTGGGAGAAGAAAGG + Intergenic
1172881044 20:38200174-38200196 CTGCCTCAGTGGAAGAGGCAGGG - Intergenic
1173564922 20:44031789-44031811 CAGCAGAAGTGGAGGGTGAAGGG + Intronic
1175691897 20:61071521-61071543 CTGAGTAAGTGGAGGGTGAGAGG + Intergenic
1176259001 20:64169170-64169192 CTGCCTGAGTGGGAGGAGAGTGG + Intronic
1177163838 21:17578354-17578376 CTTTCTAAGTGAAAGGTGTATGG + Intronic
1179213673 21:39348895-39348917 ATGCCCAAGAGGAAGGTGAGCGG - Exonic
1180942556 22:19668881-19668903 CAGTCTTTGTGGAAGGTGAACGG + Intergenic
1182517204 22:30865679-30865701 TTGCGTCAGTGGAAGGTGACCGG + Intronic
949372947 3:3354764-3354786 CTGCCTCAGTGGAGACTGAAGGG + Intergenic
950253191 3:11484069-11484091 CAGCCTAAGAGGAAGGTGATAGG + Intronic
951195303 3:19816902-19816924 CTGGCTCACTGGATGGTGAAAGG + Intergenic
951570970 3:24062880-24062902 CTGCCTAAGCAGAAGTTGAAAGG + Intergenic
953278916 3:41533006-41533028 CGGCCTGAGTGGAAGCTGCAAGG - Intronic
954916927 3:54156434-54156456 CTGCCCAGCTGGAAGGTGAGCGG + Intronic
957296117 3:78335029-78335051 CTTCCAAAATGGAAGGTCAAAGG - Intergenic
959116873 3:102188961-102188983 TTGCCAAAGTGAAAGGTGAAAGG + Intronic
960399463 3:117178600-117178622 CTGCCTAAGGTGAAGGGGACAGG + Intergenic
960492830 3:118338008-118338030 CTGCCTAATTGGTAGTTGGAGGG + Intergenic
961491148 3:127257559-127257581 ATGCCTACGTGGGAGGTGGAAGG + Intergenic
964595267 3:158420031-158420053 CTGCCTATGAGGAGGGTAAAAGG - Intronic
964794580 3:160483119-160483141 TTCCCTCAGTGGAAGGTGAAGGG - Intronic
964838094 3:160962896-160962918 CTGCTTGAGAGGGAGGTGAAGGG - Intronic
966474595 3:180329285-180329307 CGGCTTATTTGGAAGGTGAAAGG + Intergenic
968111097 3:196047482-196047504 CTGCCTATGTGAAAGGTCATGGG - Intronic
968917524 4:3503082-3503104 CTGACAAAAGGGAAGGTGAAAGG - Intergenic
970151825 4:13098070-13098092 CTTCCTAAGAGAAAGGTGCAGGG + Intergenic
972362847 4:38344961-38344983 CTGTCATAGTGGAAGTTGAAGGG - Intergenic
972589021 4:40466534-40466556 TTGCTTAAGTGGAAGGGAAAAGG + Intronic
972912931 4:43841177-43841199 CTGGCTTAGAGGAAGGGGAAGGG - Intergenic
974892661 4:67900354-67900376 CTGCCTACTTGGAAGCAGAAGGG + Intergenic
975490553 4:74983778-74983800 TTGCTAAACTGGAAGGTGAAGGG - Intronic
977595217 4:98871992-98872014 CTGCCTAAGTGGAAGGTGAAAGG + Intronic
978802381 4:112767639-112767661 TTGCCTATGGGGAAAGTGAATGG + Intergenic
979180457 4:117720497-117720519 CAGTCATAGTGGAAGGTGAAAGG - Intergenic
979389584 4:120112326-120112348 GTGCATGTGTGGAAGGTGAAGGG + Intergenic
980740009 4:136938293-136938315 CTGGGTAAGTGGAAAGAGAAGGG + Intergenic
981780231 4:148420872-148420894 CAGCCATGGTGGAAGGTGAAAGG - Intronic
982187879 4:152820553-152820575 CAGTCGTAGTGGAAGGTGAAGGG + Intronic
986468969 5:8055122-8055144 ATTCCTTAGTGGAAGGGGAACGG - Intergenic
988525594 5:31984453-31984475 CTGCCTACGTGGATGCTGACTGG + Intronic
990131493 5:52591336-52591358 TAGCCTAATAGGAAGGTGAAAGG + Intergenic
990457588 5:56003212-56003234 CTGCCTAAATTCAAGATGAAGGG - Intergenic
995859643 5:116628004-116628026 CTGCAAAAGTGGCAGGTGAATGG - Intergenic
996238859 5:121170022-121170044 CTCCCAAAGTCGAAGGTGAAAGG - Intergenic
997646791 5:135487340-135487362 CTGCCTCATTGGCAGGAGAAGGG + Intergenic
997905408 5:137811615-137811637 CAGTCATAGTGGAAGGTGAAGGG - Intergenic
999015036 5:148093412-148093434 CTGTCTAAGGTGAGGGTGAAAGG + Intronic
999665560 5:153909475-153909497 CTGCCTTTTTGGAAGATGAAAGG - Intergenic
1001765626 5:174244144-174244166 CATCCATAGTGGAAGGTGAAAGG + Intergenic
1002898978 6:1394964-1394986 CTGGCTAAGTGGCAGGTGTGTGG - Exonic
1003421455 6:5961876-5961898 CTGCCCAAGTTGAATGTCAATGG - Intergenic
1004685017 6:17934915-17934937 CTGCCTCACTGCAAGGTAAAGGG - Intronic
1005220748 6:23585448-23585470 CAGTCATAGTGGAAGGTGAAGGG - Intergenic
1006311878 6:33266847-33266869 CTGTCTAAGAGCAAGCTGAATGG + Intronic
1007094282 6:39203812-39203834 CTGCCCTAGTGGAAGCTGACAGG + Intronic
1008970878 6:57366519-57366541 CTGCAGAAGTGGAGGGTGAGTGG + Intronic
1011942412 6:92858417-92858439 CAACCATAGTGGAAGGTGAAAGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1015282771 6:131451695-131451717 CTTACTAAGTGTAAGGTGACTGG + Intergenic
1024120298 7:46229973-46229995 CTGGCTCAGTGGGAGGGGAAAGG + Intergenic
1026116194 7:67497692-67497714 ATCCCAAGGTGGAAGGTGAAAGG + Intergenic
1026159302 7:67854514-67854536 CTGACTAAGTGAAAGGAGGAAGG - Intergenic
1026639057 7:72108619-72108641 CTGCCTAAGGGCAGGGTGTATGG - Intronic
1029533311 7:101139812-101139834 CTGCATAAGTGGAAAGTTTATGG - Intergenic
1029910233 7:104137901-104137923 CTGCCTTATTGGAAGGAGAGAGG - Intronic
1032351883 7:131172038-131172060 TTGCTTTGGTGGAAGGTGAAAGG - Intronic
1032474982 7:132205439-132205461 CTGCCCCAGTGGAGGGAGAAGGG + Intronic
1032563016 7:132912256-132912278 CTGTCTAAGTGGAAGATAATAGG + Intronic
1032571786 7:133008145-133008167 CTTCCTAAGTGAAATGTGCATGG + Intronic
1032938422 7:136760864-136760886 CTACCACAGTGGAAGGTGAAGGG - Intergenic
1033537449 7:142324696-142324718 TTGCTTCAGTGAAAGGTGAATGG - Intergenic
1034923801 7:155104459-155104481 CAGGCTGAGTGGAATGTGAAGGG + Intergenic
1037588576 8:20294861-20294883 CTGCCTCTCTGGAAGGTCAAGGG + Intronic
1037911387 8:22745687-22745709 CTGCCTGAGAGCAAGGTGAGAGG + Intronic
1037934393 8:22905485-22905507 CTGCCTAGGTATAAGGTCAAAGG - Intronic
1038522490 8:28245202-28245224 CTGCCTCAGTGGGAGGTGATTGG - Intergenic
1040005936 8:42620980-42621002 CTGCCTTAGTGGCATGGGAATGG + Intergenic
1042266229 8:66911359-66911381 CAGTCATAGTGGAAGGTGAAGGG - Intronic
1043317124 8:78936885-78936907 CAACCATAGTGGAAGGTGAAAGG - Intergenic
1045192546 8:99897044-99897066 CTGCCTAAGGGAAAGATTAATGG - Intergenic
1045346335 8:101297168-101297190 CTGCCTAGATTTAAGGTGAATGG + Intergenic
1045597429 8:103672490-103672512 CAGTCACAGTGGAAGGTGAAGGG + Intronic
1045608164 8:103802434-103802456 GAGCCAAAGGGGAAGGTGAAAGG - Intronic
1046190161 8:110784775-110784797 CTATGTTAGTGGAAGGTGAAGGG + Intergenic
1047444519 8:124907316-124907338 CTCCCTTAGGGGAAGGGGAACGG + Intergenic
1047718012 8:127613569-127613591 CTGCCTCAGTGGCTGGTGTAGGG + Intergenic
1047957096 8:129984390-129984412 CTTCCTAAGTGCCAGGTGCATGG - Intronic
1048136534 8:131751886-131751908 CTGCCTATGTGCCAGGTGAGGGG - Intergenic
1051520379 9:17980880-17980902 CTGCCCATGCAGAAGGTGAAGGG + Intergenic
1052902987 9:33810732-33810754 CTGGCTAAGTTGCAGGGGAAAGG + Intergenic
1056355493 9:85797606-85797628 CTGCCCTAGGTGAAGGTGAAGGG - Intergenic
1056600410 9:88042602-88042624 CTGCCTGAGGGGAAGGTTTAGGG + Intergenic
1057479343 9:95432345-95432367 CTGCTGAAGTGGAAGGTCAAGGG + Intergenic
1057803564 9:98204719-98204741 CTTCCTAAGTCGAAGCTGAGTGG + Intronic
1060876667 9:127088934-127088956 CTGGCTTAGTGGAAGGTGTTGGG + Exonic
1187022629 X:15400187-15400209 CTGCATAAGTGGAAAATCAATGG - Intronic
1187377060 X:18764510-18764532 CTGAATAAGTTGAAGGTGGAAGG + Intronic
1191772814 X:64781244-64781266 CTGGCTAAGTGATAGATGAAAGG + Intergenic
1192936002 X:75859054-75859076 CAGGCTAAGGGGAAGGGGAATGG + Intergenic
1194792614 X:98169527-98169549 CTCAATAAGTGTAAGGTGAATGG - Intergenic
1194827229 X:98578207-98578229 CTCCCTAAGTGCAAGGTGAGGGG - Intergenic
1197117420 X:122850152-122850174 CTGCCCTAGTGGAAAATGAAAGG + Intergenic
1197892713 X:131282041-131282063 CTGGCCAAGTGGAAGTGGAAAGG - Intronic
1198146204 X:133859907-133859929 CACCCACAGTGGAAGGTGAAGGG + Intronic
1198665522 X:139018092-139018114 TTGGCTCAGTGGAAGGTGAAAGG + Intronic
1199163641 X:144645377-144645399 CTGTCAAGGTGGAAGGTGAATGG - Intergenic