ID: 977597550

View in Genome Browser
Species Human (GRCh38)
Location 4:98900229-98900251
Sequence ATTGTTCAACCTAATACATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 1, 2: 2, 3: 14, 4: 156}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977597550 Original CRISPR ATTGTTCAACCTAATACATG TGG Intronic
900073616 1:793824-793846 TTTGTTCAACCCATCACATGAGG - Intergenic
903426018 1:23254863-23254885 ATTTTTCAACCTACTACAGAGGG - Intergenic
905126661 1:35720088-35720110 ATTGCTGACCCTAATATATGAGG + Intergenic
908473279 1:64465267-64465289 ATTGTTGAACCAAATAATTGGGG - Intergenic
911180221 1:94853886-94853908 ATTGTTCCGCCTAATAGCTGAGG + Intronic
912148913 1:106831940-106831962 ATTTTTCAGCCTATTACATTTGG + Intergenic
913941486 1:125112290-125112312 ATTATTCAGCCTTAAACATGAGG - Intergenic
914924458 1:151872326-151872348 ATGGTTCAACCTAATAACTTAGG - Intergenic
916827311 1:168454695-168454717 ATTATTCAACCTAATTCAGTGGG - Intergenic
919004309 1:191875111-191875133 ATTTTTCAGCCTAATACATAAGG + Intergenic
919311316 1:195913685-195913707 ATTGTTCAGCCTTAAACATAAGG - Intergenic
919340190 1:196296218-196296240 ATTTTTCAACTTAATTCTTGGGG - Intronic
922269476 1:224018731-224018753 TTTGTTCAACCCATCACATGAGG - Intergenic
924422277 1:243920778-243920800 ATTGTTGAACTTGATACATATGG - Intergenic
924637581 1:245803382-245803404 ATGGTTCAACCTAAAACACCAGG - Intronic
1066782200 10:38963835-38963857 ATTATTCAGCCTTAAACATGAGG - Intergenic
1066951206 10:42119257-42119279 ATTATTCAGCCTTAAACATGAGG + Intergenic
1067343458 10:45421918-45421940 CTTGTTCATCCTGACACATGAGG + Intronic
1069132106 10:64718556-64718578 ATTATTCAACCTAACACAGTGGG + Intergenic
1069148292 10:64923862-64923884 TTTGTTCAACGTAATACCGGAGG + Intergenic
1070333812 10:75437250-75437272 ATAGTTGAACCTAATATCTGAGG + Intronic
1071981874 10:91011541-91011563 ATGTTTCAACCTAATATTTGGGG - Intergenic
1072130439 10:92488897-92488919 ATTGTTGAACCTAATTTATAAGG + Intronic
1072952682 10:99861560-99861582 ATTATTCAATATAATACATTAGG + Intergenic
1076423118 10:130346932-130346954 AGTGTTCAACTGAATACTTGAGG + Intergenic
1077821540 11:5747612-5747634 ATCGGTAAACCTAATAAATGAGG + Intronic
1079360207 11:19764485-19764507 ATTGTTCATGCTAACAGATGTGG + Intronic
1079835920 11:25332712-25332734 ATTATTCAACCTATAACATATGG - Intergenic
1079891570 11:26061938-26061960 ATTGTTCAAACTAAAAGAAGAGG - Intergenic
1081145335 11:39556491-39556513 ATTATTCAACCTTATAAAAGAGG + Intergenic
1081547350 11:44080948-44080970 TTTGTTCAACCAAACACATGTGG + Intronic
1083014566 11:59439868-59439890 ATACTTCAACCTATTACATAAGG + Intergenic
1083132754 11:60641191-60641213 ATGGTTCAACCTAATACAAGGGG - Intergenic
1084564446 11:69921218-69921240 ACTGTTCACTCCAATACATGAGG + Intergenic
1088189635 11:107213872-107213894 AGTGTCCAAACTAATACAAGAGG + Intergenic
1088481276 11:110298037-110298059 ATTGTTCAGCCTACCACATCAGG + Intergenic
1091066242 11:132515789-132515811 ATTCTTCAACCTCGGACATGTGG + Intronic
1092189676 12:6509945-6509967 ATTGTTCAACTGAATAAATACGG - Intronic
1093993160 12:25612755-25612777 ATTATTCAACCTATCACATATGG - Intronic
1094551198 12:31453596-31453618 ATGGTTGAACATAAGACATGGGG + Intronic
1095870686 12:47024300-47024322 ATGGTTCAACCTAATACATGAGG - Intergenic
1097772635 12:63606035-63606057 ATTTTTCTTCCTAATACATAAGG + Intronic
1097973351 12:65658830-65658852 ATTATACAACATAATATATGAGG - Intergenic
1098504762 12:71236841-71236863 ATTATTCCACTTAATAGATGAGG + Intronic
1109215436 13:59584392-59584414 ATGGTTCAACCTAGTAGAAGGGG - Intergenic
1110881250 13:80575558-80575580 ATTCATCAAGCTAATAAATGAGG - Intergenic
1111809765 13:93084848-93084870 ATTGATCAACATAATTCATGAGG + Intergenic
1114155333 14:20096709-20096731 ATTGTTTAGCCTAATAAATACGG + Intergenic
1114312502 14:21479935-21479957 ATTGTTCAACTTCATAAATGGGG - Intronic
1120039639 14:79738114-79738136 ATTTTTCAACCTACTGCAGGTGG - Intronic
1125369878 15:38962917-38962939 TTTGTTCAACAAAATACATTAGG + Intergenic
1125874499 15:43132389-43132411 ATTCTTCAAGGAAATACATGTGG - Intronic
1132388667 15:101421878-101421900 ATTGTTGAACTTAAAACTTGTGG - Intronic
1135636567 16:24080931-24080953 ATTTTTCAACCTATTTTATGAGG + Intronic
1136697069 16:32091831-32091853 ATTATTCAGCCTTAAACATGAGG + Intergenic
1136797568 16:33035122-33035144 ATTATTCAGCCTTAAACATGAGG + Intergenic
1136960457 16:34841211-34841233 ATTATTCAGCCTTAAACATGAGG - Intergenic
1137084967 16:36108529-36108551 ATTATTCAGCCTTAAACATGAGG + Intergenic
1140241819 16:73209013-73209035 ACAGTTCAACCCAATATATGAGG + Intergenic
1144145749 17:12396397-12396419 ATTGTTCTAACTAAGCCATGCGG + Intergenic
1144185521 17:12791653-12791675 ATTTTTCAGCCTCATCCATGGGG + Intronic
1145326638 17:21835976-21835998 ATTATTCAGCCTTAAACATGAGG - Intergenic
1145689609 17:26725146-26725168 ATTATTCAGCCTTAAACATGAGG - Intergenic
1146503843 17:33387533-33387555 ATTGCTCAGCCTACTACATCTGG - Intronic
1147113618 17:38282136-38282158 TTGGTTCAACCTAATAGAAGAGG + Intergenic
1148415996 17:47507049-47507071 TTGGTTCAACCTAATAGAAGAGG - Intergenic
1148937549 17:51175792-51175814 ATGGTTCAAAGAAATACATGTGG + Intergenic
1149231799 17:54543639-54543661 ATCGTTTAACCATATACATGAGG - Intergenic
1203190828 17_KI270729v1_random:186573-186595 ATTATTCAGCCTTAAACATGAGG - Intergenic
1154516383 18:15171208-15171230 ATTATTCAGCCTTAAACATGAGG + Intergenic
1157530443 18:48415966-48415988 ACTGTTCAACCCAGTACATAGGG - Intergenic
1157777988 18:50411843-50411865 ATAGTTCAACCTGATAAATGTGG + Intergenic
1158215338 18:55095050-55095072 AATGTTCAACCAGATGCATGAGG - Intergenic
1160380845 18:78454139-78454161 TTTGTTCAAGCTAATAGTTGGGG - Intergenic
1164808717 19:31139352-31139374 ATTGAACAACCCAATCCATGTGG - Intergenic
1202669049 1_KI270709v1_random:33012-33034 ATTATTCAGCCTTAAACATGAGG - Intergenic
927500944 2:23582802-23582824 ACTATTTAACCTACTACATGGGG - Intronic
928524108 2:32122011-32122033 ATTGTTCCACGTAATATAAGTGG - Intronic
930578932 2:53186176-53186198 ATTGTGCTAAGTAATACATGAGG + Intergenic
931801624 2:65764590-65764612 ATTGTTCAATGTAAGACATCAGG - Intergenic
933713989 2:85346995-85347017 ATTGTTCGACCTAATACTTCTGG + Intronic
934330851 2:92066666-92066688 ATTATTCAGCCTTAAACATGAGG - Intergenic
936166902 2:110128698-110128720 ATGGTTTAGCCTAATACATCAGG - Intronic
938516708 2:132016202-132016224 ATTATTCAGCCTTAAACATGAGG + Intergenic
940454386 2:153877388-153877410 ATTGGTGAACGTAATGCATGTGG + Intronic
945101523 2:206266790-206266812 ATTTTTCAACCTAAAACTGGGGG - Intergenic
946473832 2:219988689-219988711 ATTGTTAAACCTAAAAGGTGGGG - Intergenic
946558093 2:220881795-220881817 AATGTTCAACCTAATATTTGAGG - Intergenic
946794447 2:223334985-223335007 ATTGCTCAACGAAATAAATGAGG + Intergenic
1169928846 20:10810466-10810488 ATCATTCAACCTAAAACTTGGGG + Intergenic
1170596527 20:17810086-17810108 ATTGTTCAAACTGTTCCATGTGG - Intergenic
1172451793 20:35030740-35030762 ATTGTTGAACCTATAACATATGG - Intronic
1173357766 20:42310441-42310463 TTTGTTCAAACCAATACAAGTGG + Intronic
1177676049 21:24300532-24300554 ATTGTCCAACATAATACAAGTGG + Intergenic
1203325588 22_KI270738v1_random:12339-12361 ATTATTCAGCCTTAAACATGAGG + Intergenic
949362588 3:3247294-3247316 ATGGTTCAACCTAAAAAGTGAGG + Intergenic
957954442 3:87166276-87166298 ATTAATCTACCTAATACATAAGG - Intergenic
958634719 3:96728946-96728968 ATTATGCAAAATAATACATGGGG - Intergenic
960380513 3:116954803-116954825 ATTGTTCTGCCTACCACATGTGG + Intronic
961248152 3:125475185-125475207 ATTGATCAACCAAAGACATATGG + Intronic
962959545 3:140297832-140297854 ATGGCTCAACCTAATACAGGTGG + Intronic
963638679 3:147832374-147832396 ATTTATCAACCTAAAAAATGGGG + Intergenic
966967552 3:185010015-185010037 ATTGTTCAATCTAATCCTTTTGG - Intronic
967146928 3:186614286-186614308 ATGGTTCAACCTAATATCTCTGG - Intronic
971616222 4:28793485-28793507 AGTGTGCCACATAATACATGAGG - Intergenic
974251580 4:59392596-59392618 ATTGTTAAACCTACTACAAAAGG - Intergenic
975720018 4:77240355-77240377 GTTCTTGAACCTAATACCTGAGG - Intronic
976425902 4:84903153-84903175 ACAGTTCAATCTAATACATGTGG + Intronic
977597550 4:98900229-98900251 ATTGTTCAACCTAATACATGTGG + Intronic
979062949 4:116089215-116089237 ATGGCTTAACCTAATACATATGG - Intergenic
980207928 4:129745849-129745871 ATAGTTCAACCTAATAATTATGG - Intergenic
983223508 4:165065345-165065367 AATGTTCAACCTTTGACATGTGG + Intergenic
983283058 4:165705429-165705451 ATTGTTCAAGCTACTACACTAGG - Intergenic
985968822 5:3358857-3358879 TTTGTGAAACCTATTACATGAGG + Intergenic
986969929 5:13320825-13320847 ACTGTTTAAACTAATCCATGTGG + Intergenic
987214582 5:15720601-15720623 ATTGCTCAAGTTAATAAATGGGG - Intronic
987451565 5:18090522-18090544 ATGTTCGAACCTAATACATGAGG - Intergenic
989024918 5:37056138-37056160 AGTGTTAAAACTAATAGATGAGG + Intronic
989126078 5:38053473-38053495 ACTGTTGAACATAACACATGTGG - Intergenic
993398368 5:87418595-87418617 TTTGTTCAACCTAATAGAAAAGG - Intergenic
993800979 5:92336536-92336558 ATTGTTCATCAAAATATATGAGG - Intergenic
993850652 5:93004044-93004066 ATTGTTCAACTTAATACATTTGG + Intergenic
998891434 5:146750491-146750513 GTTCTTAAACCTGATACATGCGG - Intronic
1000258558 5:159564024-159564046 ATGTTTCAACTTAATAAATGAGG - Intergenic
1000366669 5:160497789-160497811 TTTTTTCAATCTAATACAGGTGG + Intergenic
1000474633 5:161690720-161690742 ATGGTTCAACCTAATAAAAGGGG - Intronic
1000891619 5:166809095-166809117 GTTGTTTATCCTAATACATTAGG + Intergenic
1001509820 5:172312284-172312306 ATAGTTCAACCTACCACAGGTGG + Intergenic
1005165012 6:22909598-22909620 ATTATACAACATAATACATCAGG - Intergenic
1009267909 6:61579479-61579501 AATGATCAACCTAAAGCATGTGG - Intergenic
1010741711 6:79513796-79513818 TTTGTTCATCCTAACACAAGTGG + Intronic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1016031221 6:139340553-139340575 GTTCTTCAACCAAAGACATGAGG - Intergenic
1016776792 6:147913363-147913385 ATTGATCAAACACATACATGAGG + Intergenic
1017338763 6:153294526-153294548 ATTATTAAACTAAATACATGTGG + Intergenic
1017916993 6:158838925-158838947 ATTCTTCAATATAATACATAGGG - Intergenic
1020769830 7:12376220-12376242 ATTCCTCAAGCCAATACATGAGG + Intronic
1021382124 7:19980717-19980739 ATTATTCAACATAGTACTTGAGG - Intergenic
1022365596 7:29712620-29712642 ATTTTTCTTCCTAATACATAAGG - Intergenic
1022695922 7:32705531-32705553 ATTTTTCTTCCTAATACATAAGG + Intergenic
1022932195 7:35129726-35129748 ATTTTTCTTCCTAATACATAAGG + Intergenic
1024807117 7:53155631-53155653 ATTATTCAGCCTTAAACATGAGG + Intergenic
1024925237 7:54605466-54605488 ATTCTTCAACCTAATTTTTGAGG + Intergenic
1025319565 7:58080559-58080581 ATTATTCAGCCTTAAACATGAGG - Intergenic
1025477978 7:60951029-60951051 ATTATTCAGCCTTAAACATGAGG - Intergenic
1030180376 7:106701534-106701556 ATTGTTTAACCTCATATTTGAGG + Intergenic
1033492602 7:141858678-141858700 TTTGTTGAACCTCAGACATGTGG + Intergenic
1034878218 7:154743904-154743926 TTTTTTCAACCAAATACATATGG - Intronic
1037209199 8:16364586-16364608 ATTGCTTAACCTAATAATTGGGG - Intronic
1045803093 8:106124044-106124066 ATTGTTAAATCTGATACATATGG - Intergenic
1050681601 9:8117895-8117917 ATTGTTCCACTTAATAGTTGAGG + Intergenic
1051699044 9:19800204-19800226 ATTTTTCAACCCACTACTTGTGG + Intergenic
1052498137 9:29254536-29254558 ATTGTTCAAGGTAATGCATTGGG - Intergenic
1052570787 9:30219531-30219553 ATTGTTCCAAATATTACATGGGG + Intergenic
1053945463 9:43304735-43304757 ATTATTCAGCCTTAAACATGAGG - Intergenic
1054579186 9:66894628-66894650 TTTGTTCAACCTTATTCTTGCGG - Intronic
1056032524 9:82567714-82567736 AATGTTCAAACTATGACATGAGG - Intergenic
1056347523 9:85713643-85713665 ATTGTTTAACTTAATACATTTGG + Intronic
1056861773 9:90191692-90191714 ATTGTTTAATCATATACATGAGG + Intergenic
1057583196 9:96306014-96306036 ATTTCTCAATCTATTACATGGGG - Intergenic
1059014082 9:110495214-110495236 GTTATTCAGCCTACTACATGGGG - Intronic
1203588598 Un_KI270747v1:33313-33335 ATTATTCAGCCTTAAACATGAGG - Intergenic
1186379263 X:9039912-9039934 ATTATTCTACCTACTACAGGTGG + Intronic
1187553034 X:20324995-20325017 ATTGAACAAATTAATACATGGGG - Intergenic
1188047272 X:25440496-25440518 ACTGTTCTACCAATTACATGAGG - Intergenic
1188351573 X:29137504-29137526 ATTGTACCACCTGATAAATGTGG - Intronic
1189501673 X:41566565-41566587 ATTGCTCAACGAAATAAATGAGG + Intronic
1191692759 X:63957967-63957989 ATGGTTCAACCTAATAGTAGGGG + Intergenic
1191874337 X:65779816-65779838 ATTGTTCAACCAAATAAAAGAGG + Intergenic
1196531520 X:116792485-116792507 ATTGTTGAACTTCATACATTAGG - Intergenic
1199283177 X:146026099-146026121 ATTGCTCCACCTAATTCATCTGG - Intergenic
1199283772 X:146033738-146033760 ATTGTGCAACCTAAAACATCTGG - Intergenic
1200113573 X:153758225-153758247 CTTGTTCAATCTAATACACACGG - Intergenic
1201691155 Y:16766545-16766567 ACTGTTCAACATAATAAAGGAGG + Intergenic