ID: 977597683

View in Genome Browser
Species Human (GRCh38)
Location 4:98901532-98901554
Sequence AGAAGAATGCCTATGAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 272}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977597683_977597687 14 Left 977597683 4:98901532-98901554 CCATCCTTCATAGGCATTCTTCT 0: 1
1: 0
2: 1
3: 26
4: 272
Right 977597687 4:98901569-98901591 CTATATGATGCTAGTATCCCCGG 0: 1
1: 0
2: 0
3: 4
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977597683 Original CRISPR AGAAGAATGCCTATGAAGGA TGG (reversed) Intronic
902273964 1:15325982-15326004 AGAGGAAGCCCTATGAATGATGG - Intronic
903639733 1:24849982-24850004 AAAAGCATGTCTACGAAGGAAGG - Intergenic
904466201 1:30708992-30709014 AGGAGCCTGACTATGAAGGAAGG - Intergenic
905503881 1:38461049-38461071 AGAAGAATTCCATTGAAAGAGGG - Intergenic
906088287 1:43155167-43155189 AGAAGAAAGGTTGTGAAGGATGG + Intronic
906278951 1:44540063-44540085 GGAAGAATGCCTTTAAATGATGG - Intronic
906660361 1:47577661-47577683 ACAAGAATGCCCATCCAGGAGGG + Intergenic
907132625 1:52110034-52110056 AGAAGGATGCCTAGTGAGGAGGG - Intergenic
907978098 1:59453219-59453241 TGAATAATCCCAATGAAGGAGGG + Intronic
908019640 1:59886629-59886651 GTAGGAATGCCCATGAAGGAGGG + Intergenic
908925291 1:69247267-69247289 AGAAGAATGCTTAAAAGGGAGGG - Intergenic
910295287 1:85637846-85637868 AGAAGCAAACCTATGAAGGCTGG + Intergenic
912169508 1:107081502-107081524 AGAAGAATGGAAAGGAAGGAAGG + Intergenic
912963660 1:114218071-114218093 AGGAGAGTGACTCTGAAGGAGGG + Intergenic
913672439 1:121110376-121110398 AGAATAAGTCCTATGAAGGTAGG - Intergenic
914024203 1:143897740-143897762 AGAATAAGTCCTATGAAGGTAGG - Intergenic
914662696 1:149805767-149805789 AGAATAAGTCCTATGAAGGTAGG - Intronic
914828142 1:151150597-151150619 AGAAGAAAGCATTTCAAGGAGGG - Intergenic
916851557 1:168709693-168709715 TGAAGAATGCCTTTCAAAGAGGG + Intronic
917068840 1:171127116-171127138 AGAAGAATGACAATGAAGAGGGG - Intergenic
917999673 1:180480501-180480523 AGAAGAAAGCATCTGAAGGCAGG + Intronic
919002397 1:191849316-191849338 ACAATAAAGACTATGAAGGAGGG + Intergenic
921625676 1:217375196-217375218 AAAAGAATACCTGTGAAGGTGGG + Intergenic
1064337716 10:14458656-14458678 AAAAAAATGCATGTGAAGGAAGG - Intronic
1064533746 10:16336726-16336748 AGAAAAAAACCTAAGAAGGAAGG - Intergenic
1064695237 10:17958306-17958328 AGAAGAATGTCTATGATGCAAGG - Intronic
1064938213 10:20703979-20704001 GGAATGATGCCTATGAAGAAGGG + Intergenic
1066296900 10:34061788-34061810 AGAAGAATGTCTCTGAAAGAAGG - Intergenic
1067515983 10:46944902-46944924 AGAAGATTGACTATGCATGAGGG + Intronic
1067646265 10:48106908-48106930 AGAAGATTGACTATGCATGAGGG - Intergenic
1068424958 10:56847854-56847876 AGAATATTGCCTTTGAAGGAAGG - Intergenic
1069181202 10:65361159-65361181 AGATGAATGCCTAAGAACCAGGG - Intergenic
1069408871 10:68131672-68131694 AGAATACCGCCTATGAAGGCTGG - Intronic
1069682407 10:70294688-70294710 AATAAAATTCCTATGAAGGAAGG - Intergenic
1072930166 10:99655675-99655697 AGAAGAATGCCCAGGGAGGAGGG - Intergenic
1073985205 10:109200492-109200514 AGAAGAGTGCTTAAGAAAGAGGG - Intergenic
1074933759 10:118157473-118157495 AGAAAAAAACCTATGAAGGCAGG - Intergenic
1079740998 11:24060267-24060289 AGAAATATGACTTTGAAGGAAGG - Intergenic
1081323216 11:41716269-41716291 AGAAGAAAGACTTTGACGGAGGG + Intergenic
1081508277 11:43740873-43740895 GGAAGAATGGGTATTAAGGAAGG + Intronic
1084848428 11:71919076-71919098 AAAAGGATGCCCATGAATGAGGG + Intronic
1085113519 11:73909827-73909849 AGATAAATGCCTATAAAGCAGGG + Intronic
1085160950 11:74344240-74344262 ATAAGAGTGCCTATGAAAGTTGG + Intronic
1086036850 11:82426151-82426173 AGAAGAAAGCGAAGGAAGGAAGG + Intergenic
1087394642 11:97582063-97582085 AGAAGCATGACTAGGATGGAAGG + Intergenic
1087832500 11:102834680-102834702 AGAAGAAGGTTTGTGAAGGAAGG - Intergenic
1088010414 11:104994404-104994426 AGAAGAATCATAATGAAGGATGG - Intronic
1088924340 11:114285131-114285153 AGAAGGATGCCAAGGAGGGAGGG - Intronic
1088941695 11:114465472-114465494 AGTGGAATGATTATGAAGGAAGG + Intergenic
1090810232 11:130233275-130233297 AGAAGAGTTCCTATGAAGCTGGG + Exonic
1091737123 12:2932083-2932105 GGAAGGATGCCTATATAGGATGG + Intronic
1092071045 12:5631676-5631698 AGGAGAAGCCCTTTGAAGGAGGG + Intronic
1093499082 12:19790270-19790292 AGCAGAAAGCCAAAGAAGGAGGG + Intergenic
1093728086 12:22539080-22539102 AGATGTATGGCTATGAAGGGGGG - Intronic
1096011823 12:48223949-48223971 AGGAGAATACCAATGAGGGAAGG - Intergenic
1096444322 12:51675161-51675183 GGAAGAATGGCCATGGAGGAGGG + Intronic
1096744371 12:53715822-53715844 AGAAAAATGCCAATGGAGCAAGG - Exonic
1098725036 12:73953288-73953310 GGAAGCATGCTTATAAAGGAGGG - Intergenic
1099069684 12:78030287-78030309 AGATGAAAGCCAATAAAGGATGG - Intronic
1100189324 12:92173776-92173798 AGAAGAAAGCCTTTGAAAGTAGG + Intergenic
1101809796 12:108097793-108097815 AGAAGAAGGCGTAAGAAGGGAGG + Intergenic
1105818940 13:24062781-24062803 TCAAGAAGGGCTATGAAGGATGG - Intronic
1105829960 13:24155430-24155452 AGAATACTGCTTGTGAAGGATGG + Intronic
1108753784 13:53475666-53475688 GGAAGAATGGCAAGGAAGGAGGG - Intergenic
1109219279 13:59625097-59625119 ACAAGTAGGCCCATGAAGGAGGG + Intergenic
1109933706 13:69250821-69250843 AGAGGAATGATTATGAAGGCAGG - Intergenic
1110029232 13:70585210-70585232 AGAAGAATGTCTGTGCAGGAGGG + Intergenic
1110084837 13:71364686-71364708 AGCAGAATGGTTTTGAAGGATGG - Intergenic
1110430213 13:75414581-75414603 AGAAGAAAGGGTATGCAGGATGG + Intronic
1110449509 13:75625825-75625847 AGAAGATTCCCTATGAAACAAGG - Intronic
1110458297 13:75714959-75714981 GGAAGTGTGCCTATGAAGCACGG + Intronic
1110530644 13:76593486-76593508 AGAAGAGTTCCTATGAAGCTGGG - Intergenic
1110546019 13:76756120-76756142 AGAAGAATGGGGATGGAGGAAGG - Intergenic
1110846067 13:80191737-80191759 AGAAGTATGCCTCAGCAGGAGGG - Intergenic
1111005950 13:82249056-82249078 AGGAGAAGGCATATGATGGATGG + Intergenic
1114004721 14:18300052-18300074 AGAAGAAGGCCAATGACAGACGG - Intergenic
1114479438 14:23023198-23023220 AGTAGAATGTTCATGAAGGAAGG - Intronic
1116296245 14:43113909-43113931 AGGTGAATTCCTATGCAGGAAGG - Intergenic
1117011824 14:51478642-51478664 GAAAGTATGCCTATGAAGAATGG + Intergenic
1117688575 14:58281202-58281224 ATTATATTGCCTATGAAGGAAGG - Intronic
1117812319 14:59560808-59560830 ACAAAAATGCCCATGAGGGACGG - Intronic
1118215550 14:63804788-63804810 AGAAGAAAACCTAGGAAGGCTGG - Intergenic
1118504145 14:66392182-66392204 ATAAGATAGCCTATTAAGGAGGG + Intergenic
1118865431 14:69699558-69699580 ATAAGGATGCCTAAGAAGAAAGG - Intronic
1118885641 14:69863814-69863836 AGAAGATGACCTAGGAAGGATGG + Intronic
1119181733 14:72609983-72610005 AGAGAAATGCCTATGAAAGAGGG - Intergenic
1119622003 14:76138437-76138459 AGAAGGATGGCGATGATGGAAGG - Intergenic
1120423241 14:84314944-84314966 AGTAGTATGCCTATGACAGATGG + Intergenic
1121855317 14:97263978-97264000 AGAAAAATGCTTATAGAGGAAGG + Intergenic
1121863626 14:97342109-97342131 GGAACAAGGGCTATGAAGGAAGG - Intergenic
1123389183 15:19852298-19852320 AGAAGAAGGCCAATGACAGACGG - Intergenic
1124717152 15:32074002-32074024 AGAAGGAGGACAATGAAGGAAGG - Intronic
1125083055 15:35698031-35698053 AAAAGAATGCTTACTAAGGAGGG + Intergenic
1127018575 15:54718186-54718208 AGAAGAATGCAGAAGAAAGATGG + Intergenic
1127300938 15:57653049-57653071 AGCAGAATGTCTATAAATGAGGG + Intronic
1130261985 15:82362343-82362365 AGAATAATATCTATGAAGGTAGG + Intergenic
1130279247 15:82506664-82506686 AGAATAATATCTATGAAGGTAGG - Intergenic
1130622885 15:85482394-85482416 AGAATAATATCTATGAAGGTAGG + Intronic
1131673375 15:94646015-94646037 AGAAGAACCCCTAAGAATGATGG - Intergenic
1131936355 15:97509965-97509987 AGTAGGATGCCTGGGAAGGAAGG - Intergenic
1132246173 15:100297975-100297997 AGCAGAGTGCCCAGGAAGGAAGG + Intronic
1134676793 16:16096333-16096355 GGGAGAAGGCCTAGGAAGGAAGG - Intronic
1139588287 16:67918441-67918463 AGCAGAGTGGCTATGAAGGTGGG - Intronic
1139697395 16:68684934-68684956 AGAAGAGAACCTATGCAGGAGGG - Intronic
1140890992 16:79285151-79285173 AGACAAATGCCTATGAAGCCAGG - Intergenic
1141378571 16:83554446-83554468 AGCAGCATGGCTGTGAAGGAAGG + Intronic
1143744068 17:8977071-8977093 AGAAGAATTCCTATAAAACAAGG + Intergenic
1146749365 17:35363957-35363979 AGAAGAATGGCTGGCAAGGAAGG + Intronic
1148197740 17:45726848-45726870 AGAAGAAAGCACATGTAGGAGGG - Intergenic
1148714380 17:49705378-49705400 AAAAGAATGACTGAGAAGGAAGG + Intronic
1148831287 17:50433552-50433574 AGAAGAGTGCCTAGGAATCAGGG - Intronic
1150512626 17:65773224-65773246 AGAAATGTGCCTGTGAAGGAAGG - Intronic
1150753143 17:67884710-67884732 AAGAAAATGCCTATGAAGGCTGG - Intronic
1150862884 17:68819315-68819337 AGAAAAATGTCTAGGATGGATGG + Intergenic
1151536001 17:74739042-74739064 AGCAGAAGGGGTATGAAGGATGG - Intronic
1151581400 17:74981332-74981354 GGAAGAAGGCCGAAGAAGGAAGG + Intergenic
1153665468 18:7364212-7364234 AGAGGATTGCATATGTAGGATGG - Intergenic
1154532705 18:15363816-15363838 AGAAGAAGGCCAATGACAGACGG + Intergenic
1155553224 18:26989558-26989580 GGAAAAATGCCTAGGAAGGTTGG - Intronic
1156252634 18:35365701-35365723 AGATGAATGCATATGAAGAGGGG + Intergenic
1156505080 18:37585415-37585437 CGGAGAATTCCTATGAAGGGAGG + Intergenic
1156840803 18:41607741-41607763 AGAAGAATATTTATGTAGGAAGG - Intergenic
1157239908 18:45999227-45999249 AGAAGCATGGCTATGAGGGAGGG - Intronic
1158576586 18:58643827-58643849 CTAACAATGCCTAGGAAGGAAGG + Intergenic
1162320445 19:9968341-9968363 GGAAGAATGCATTTGAAGGAGGG - Intronic
1164738054 19:30556476-30556498 AGAAGAATGCCTTTGGAATATGG - Intronic
1165729579 19:38136206-38136228 AGAAGAATGCGTAAGAAAGTGGG + Intronic
1167806282 19:51788375-51788397 AGAAGATTCCCAAGGAAGGAAGG + Intronic
925776500 2:7340702-7340724 AGAAGAATGAGAAAGAAGGAGGG - Intergenic
929154710 2:38779067-38779089 AGAAGAATGAGTATAAAGGATGG + Exonic
930160813 2:48154931-48154953 ATAAGAATGCCTTTTGAGGAGGG - Intergenic
930393778 2:50794152-50794174 TGAAAAATGCCTATGAAAAAGGG - Intronic
931754575 2:65361165-65361187 AGAAGAATGCTTTTTAAGGGAGG - Intronic
932833402 2:75011886-75011908 ATAAAAATGCCCATGAAGGCCGG + Intergenic
933261247 2:80134258-80134280 AGAAGGAGGCCTAAGAATGAAGG + Intronic
933503921 2:83153486-83153508 AGATGAATGCCCATGAGGGAAGG + Intergenic
935849712 2:107205149-107205171 AGAAGAATACGGAAGAAGGAAGG + Intergenic
938531802 2:132195043-132195065 AGAAGAAGGCCAATGACAGATGG + Intronic
939639286 2:144619538-144619560 AGGAGAATGTCTATCAATGAAGG - Intergenic
940865719 2:158816097-158816119 AGAAGAGTGCTTATGTAGGGAGG - Intronic
941944279 2:171077442-171077464 AGAACCTTGACTATGAAGGAAGG - Intronic
942846620 2:180433922-180433944 AGAAGAATGAACATTAAGGAGGG - Intergenic
943785492 2:191873719-191873741 AGAAGAAAGCATATGAATAATGG - Intergenic
945707508 2:213254245-213254267 AGAAGAGTGCCTATGGCGGAAGG - Intergenic
946365820 2:219248408-219248430 TGAAGAATGCCTGTGGAGGGAGG - Exonic
1169651161 20:7869050-7869072 AGAAGAATCCATGTGTAGGATGG - Intergenic
1170511861 20:17085817-17085839 AAAAGAAGGACTGTGAAGGAAGG + Intergenic
1171069024 20:22048241-22048263 AGAAGGATCCCTTTGAAAGAGGG + Intergenic
1173059651 20:39649262-39649284 AGAAGCATGCTTATAAAAGAAGG - Intergenic
1173709020 20:45138453-45138475 AGATGAATGCTTCTGCAGGAAGG + Intergenic
1174617576 20:51847803-51847825 AGAAGGCTGCCTTTCAAGGAAGG + Intergenic
1176764656 21:13004395-13004417 AGAAGAAGGCCAATGACAGACGG - Intergenic
1177691231 21:24510221-24510243 AGAAGACTGCCATTGATGGAAGG + Intergenic
1178675909 21:34631535-34631557 AGGAGAATTCCTATGATGAAGGG + Intergenic
1178887677 21:36496660-36496682 AGAAGAAAGCAGAGGAAGGAAGG + Intronic
1180429235 22:15230842-15230864 AGAAGAAGGCCAATGACAGACGG - Intergenic
1180511851 22:16099199-16099221 AGAAGAAGGCCAATGACAGACGG - Intergenic
1182262594 22:29085676-29085698 AGAAGAATGCCTAAGTAGGCCGG + Intronic
1183226768 22:36555716-36555738 AGAATAATGGGTATGAATGAGGG + Intergenic
1183825903 22:40387206-40387228 AGAAGGAAACCTATGAAAGAAGG - Intronic
1185156041 22:49194104-49194126 AGAAGGAGGCATAGGAAGGATGG + Intergenic
949385804 3:3501260-3501282 AGAAGAATGAACATGATGGAGGG - Intergenic
951851798 3:27149667-27149689 ATAGGAAGGCCTATGAAGAAGGG - Intronic
952215223 3:31271675-31271697 AGAAGTATCCCTCTAAAGGATGG + Intergenic
952930369 3:38355574-38355596 AGGAGAGTGCCTAGGAAGAAAGG - Intronic
952983558 3:38757801-38757823 TGAAGATGGCCTATGAAGGAAGG + Intronic
953840933 3:46389792-46389814 CCAACAATGCCTAAGAAGGAAGG + Intergenic
954899815 3:54008991-54009013 AGAAGCCTGCCTGTGGAGGAAGG - Intergenic
955600036 3:60635430-60635452 AGAAAACGGCTTATGAAGGAGGG - Intronic
956042161 3:65155907-65155929 AGAACAATGCCCATGAAGGAAGG - Intergenic
957178001 3:76837949-76837971 AGAAGACTGCATATAAAGGTTGG - Intronic
957260445 3:77895685-77895707 AGATGAATGAATATGAAGGCAGG + Intergenic
957375503 3:79351980-79352002 AGAGGAATGCTTATGTAGAATGG - Intronic
957523553 3:81351450-81351472 AGAAGGATGCAGATGAATGATGG + Intergenic
957588761 3:82168017-82168039 AGCAGAAGAGCTATGAAGGAGGG - Intergenic
959122184 3:102245836-102245858 ACTAGTATGCCTATGAAAGAAGG - Intronic
959650076 3:108743026-108743048 AGTAGAATGTCTATGAATCATGG + Intergenic
959780371 3:110225032-110225054 AGAAGAATGCATTTAAATGAGGG - Intergenic
960010956 3:112834325-112834347 ATAAGAATGACAATGAAGGGAGG - Intronic
960106539 3:113803945-113803967 TGAAGAAGGCTTCTGAAGGAGGG - Intronic
961552088 3:127675224-127675246 AGAAGAATGGCACTGAATGAAGG - Intronic
962051419 3:131819785-131819807 AGAAGAATGCCAAGGAATAAAGG + Intronic
964057341 3:152477502-152477524 AGAAGAATGCCAGTGTAGGCTGG - Intergenic
967533334 3:190574358-190574380 AGAAGATTGCAGATGAATGAAGG + Intronic
967896957 3:194403742-194403764 TGAAGAATGCCTGTGAAGCCAGG - Exonic
967999909 3:195198203-195198225 AGAAGTATGCTTGGGAAGGAAGG + Intronic
968171533 3:196514090-196514112 AGAAGAATGTGTCTGGAGGATGG - Intronic
970687266 4:18582848-18582870 TGAAGAAAGCCTATGAATAATGG + Intergenic
972026812 4:34389847-34389869 AAATGAATGCTTATGAAGCAAGG + Intergenic
972290038 4:37683458-37683480 TTAAAAATGCCTATGAAGGCTGG + Intronic
973137636 4:46727601-46727623 AGAAGTATGCCTTAGAAGGTCGG - Intergenic
973694553 4:53477215-53477237 ACAAGAATACCGCTGAAGGAAGG + Intronic
973804024 4:54507478-54507500 ATCAGAATGCTTATAAAGGAGGG + Intergenic
973882819 4:55290998-55291020 GGAAGCATCACTATGAAGGATGG - Intergenic
975985007 4:80194250-80194272 AGAAGAATGACAATGAAGAGTGG - Intronic
977007511 4:91588878-91588900 ATAAAAATGCCTTTGAAGTAAGG + Intronic
977597683 4:98901532-98901554 AGAAGAATGCCTATGAAGGATGG - Intronic
977634146 4:99276362-99276384 AGTAGAATGGTTAAGAAGGAAGG + Exonic
977636797 4:99307580-99307602 AGTAGAATGGTTAAGAAGGAAGG + Exonic
978366159 4:107985060-107985082 AGAAGATTTCCAATGCAGGAAGG + Intergenic
979010957 4:115367030-115367052 AGAATACTGGCTTTGAAGGATGG - Intergenic
980145455 4:128978114-128978136 AGTAGAATGGCTATGATTGAAGG - Intronic
980272224 4:130599846-130599868 AGAAGAATGCTTACGAAGGTAGG + Intergenic
983710941 4:170714422-170714444 ACAAGAATGCTTATGAAAGGAGG - Intergenic
983918802 4:173322204-173322226 AGCAGCATGACTGTGAAGGAAGG - Exonic
985028479 4:185763381-185763403 AGGAGAATGGCTGGGAAGGAAGG - Intronic
985804722 5:2034223-2034245 AGAAAAATGCTTGTGAATGAAGG - Intergenic
986652828 5:9981231-9981253 GGAAGACTGGCTGTGAAGGATGG + Intergenic
986800510 5:11255622-11255644 AGTAGGATGCAGATGAAGGAAGG + Intronic
988919343 5:35926131-35926153 AGAAGAATGGATAGGAAGGCGGG + Intronic
990324956 5:54666124-54666146 AGAAGAATGACTGTAAAGGAAGG - Intergenic
991966334 5:72095105-72095127 AGAGTAAGGCCTATGAAGGGAGG + Intergenic
993153274 5:84188428-84188450 AGAAGAAGGCCTGTGAAGACAGG - Intronic
995060535 5:107807912-107807934 AGAAGAATGTGTGTGAAGCAGGG + Intergenic
996167607 5:120244503-120244525 AGAAAGCTCCCTATGAAGGAGGG + Intergenic
996261498 5:121475935-121475957 AGAAGAATGCAGAGGCAGGAGGG + Intergenic
997083974 5:130774776-130774798 AGAAGGAAGGCTATCAAGGAAGG + Intergenic
997904854 5:137806425-137806447 AGAAGAAAGCATCTGGAGGAAGG + Intergenic
999533535 5:152489464-152489486 AGAACTCTGCCTATGAAGGTAGG + Intergenic
999601714 5:153273449-153273471 AGAAGTATGCCAAGGAAGTATGG + Intergenic
1000264278 5:159619793-159619815 AGAATAGTCCCTGTGAAGGAGGG + Intergenic
1001877544 5:175214490-175214512 AGCAGACTGCCTAGGAAGGAGGG - Intergenic
1002639714 5:180625000-180625022 AGAAGAATACCTATGAACCTTGG + Intronic
1002668864 5:180848831-180848853 AGAAGAGAACCTATGAGGGAGGG - Exonic
1002838327 6:884224-884246 AGCAGAATTCCTCTGAAGTATGG + Intergenic
1003721052 6:8702380-8702402 AGAAGAATCCCAGTGAAGGCTGG - Intergenic
1004721569 6:18272307-18272329 AGAAGAGTGAAGATGAAGGAGGG + Intergenic
1005444910 6:25912553-25912575 AGAAGAATGAATGTGAAGGAAGG - Intergenic
1008860814 6:56147973-56147995 AGAAGACAGCCTATGAGGGAGGG - Intronic
1009403380 6:63282554-63282576 AGAAGCATGGCTATCAAAGAGGG + Intronic
1009451031 6:63800888-63800910 GGAGGCATGCCTATGAAGCATGG + Intronic
1009681789 6:66903174-66903196 TGAAGACTGCCTATGTAAGATGG + Intergenic
1011344247 6:86351705-86351727 AACAGAGTGCCTATGAATGAGGG - Intergenic
1012370710 6:98503323-98503345 AGAAGAAAGGCAAGGAAGGAAGG - Intergenic
1014796719 6:125733454-125733476 AAAAGAAAGCCTATGAAGAAAGG + Intergenic
1014920657 6:127211477-127211499 AGAAGGATGTACATGAAGGAAGG + Intergenic
1016813419 6:148282353-148282375 GGCAGGATGCCTGTGAAGGATGG - Intronic
1018153000 6:160957475-160957497 ATAAAAATGCCTCTGGAGGATGG - Intergenic
1018266196 6:162027225-162027247 AGATGAATTCCTATGAAGTATGG - Intronic
1019064973 6:169288886-169288908 AGAAGAAGGCCTAGGCAGGCAGG - Intergenic
1021496540 7:21281077-21281099 TGAAGATTGCCAATGAAAGAAGG - Intergenic
1021961669 7:25879188-25879210 AGAAGAATCCAAGTGAAGGAAGG + Intergenic
1023532929 7:41177203-41177225 AGAAGTATGCTTAAGATGGAAGG + Intergenic
1024387742 7:48772909-48772931 AGCAGAATGGCTATTTAGGAGGG + Intergenic
1024934935 7:54702307-54702329 AAGAGAATGTCTGTGAAGGAAGG + Intergenic
1025604704 7:63031088-63031110 AAAAAAATGCCTATGAATGACGG - Intergenic
1027349157 7:77292950-77292972 AGATGAATGGCTATCAAAGAAGG + Exonic
1027425140 7:78054571-78054593 AAAAGTATGCCTATGAATGAAGG - Intronic
1028340037 7:89706803-89706825 AAAAGAACACCTGTGAAGGATGG + Intergenic
1029122512 7:98278409-98278431 AGAAAAATGTCTTTGAAGGGAGG - Intronic
1029231225 7:99070497-99070519 AGAAGAATGCAAATAAAGAAAGG - Intronic
1032189219 7:129753836-129753858 ATAAGCTTGACTATGAAGGAAGG + Intronic
1034914256 7:155023764-155023786 AGAAATATGACTATGAAGAAAGG - Intergenic
1035346848 7:158205987-158206009 TGAAGGCTGCCTATGATGGAAGG + Intronic
1035811241 8:2493053-2493075 AGAAGAAGGGAGATGAAGGAAGG + Intergenic
1035836240 8:2755482-2755504 AGAAGAATGAATATGAAGCATGG - Intergenic
1036402742 8:8425019-8425041 AGAATTATGCCAATAAAGGAAGG + Intergenic
1036966391 8:13302805-13302827 AGAGGAATGGCCATGAAGGCAGG - Intronic
1036975022 8:13401166-13401188 AGAAGACTGACAATTAAGGAAGG + Intronic
1038248217 8:25878766-25878788 AGAAGAAATGCTATCAAGGATGG - Intronic
1038949172 8:32394971-32394993 AGAAGAATGGCTATAAGGAATGG + Intronic
1039136814 8:34334180-34334202 AGAAGAATATCGAGGAAGGAAGG - Intergenic
1039907363 8:41796952-41796974 AGAAATATGTCTACGAAGGAAGG - Intronic
1041180225 8:55239601-55239623 AGAAGAATGTCTATATAGAAAGG - Intronic
1044082075 8:87897517-87897539 AGAAGAAAGCATATGGAAGAGGG + Intergenic
1044257945 8:90088090-90088112 AGAAAAATGCTGAAGAAGGAAGG - Intronic
1045207078 8:100054304-100054326 GGAAGAATGACTATGCATGATGG + Intronic
1045703114 8:104889599-104889621 TGAAGGATGACTAGGAAGGAGGG + Intronic
1046950897 8:120018838-120018860 AGAAGAATCCCTGCAAAGGAAGG - Intronic
1047456535 8:125018046-125018068 AGAAGAACACCTATGAAGAGAGG - Exonic
1048031394 8:130636540-130636562 AGAAGAAAACCTGTGAGGGAAGG + Intergenic
1050418805 9:5440912-5440934 AGGAGAATGAATATGATGGAAGG - Intergenic
1051359174 9:16266609-16266631 AGAAGGATCCATTTGAAGGATGG - Intronic
1052233671 9:26185511-26185533 AGAAGAAAGCATATGAATAAGGG - Intergenic
1053710414 9:40801535-40801557 AGAAGAAGGCCAATGACAGACGG + Intergenic
1054420322 9:64922324-64922346 AGAAGAAGGCCAATGACAGACGG + Intergenic
1055252015 9:74319077-74319099 AGATGAAAGCCTATGGAGGAAGG - Intergenic
1056031100 9:82554213-82554235 AGGAGAATGGCTACAAAGGAAGG + Intergenic
1056738890 9:89235679-89235701 TGGAGAGTGACTATGAAGGAAGG + Intergenic
1058102060 9:100927198-100927220 AGAGGAATGCCTATGGAGATGGG + Intergenic
1058295477 9:103301244-103301266 AGGGAAATGCCTATGCAGGAAGG - Intergenic
1060132376 9:121116350-121116372 AAAAAAATGCCTATGAAGCCTGG - Intronic
1060559698 9:124532928-124532950 AGAAAAATTCCTACCAAGGAAGG + Intronic
1061442985 9:130619139-130619161 AAAAGAAGGCCTCTGAGGGAGGG - Intronic
1062088618 9:134662157-134662179 AAAAAAATTCCTCTGAAGGAGGG + Intronic
1186770085 X:12809748-12809770 AATAGAATGGCTATGCAGGACGG - Intronic
1189153679 X:38733409-38733431 AGAAGAATAGCTATGCTGGATGG + Intergenic
1190962138 X:55263213-55263235 GGAAGAATGCCTATGAATGGAGG - Intronic
1190971494 X:55353342-55353364 AGAAGAATGCCTATGGATGGAGG + Intergenic
1191107965 X:56783958-56783980 AGAAGAATCCAGAAGAAGGAGGG - Intergenic
1192317213 X:70062358-70062380 AGAAGAATGCGAATGGGGGAGGG + Intergenic
1193046102 X:77056213-77056235 AGAAGAATGCAAAGGAGGGATGG + Intergenic
1194234173 X:91361655-91361677 AGAAGAAAGAATATGAATGAGGG + Intergenic
1195013106 X:100752507-100752529 AGAAGGGTGTCTATGAAGGCAGG + Intergenic
1195175478 X:102311306-102311328 AGAAGACTGCCCAAGAAAGATGG + Intronic
1195183386 X:102375787-102375809 AGAAGACTGCCCAAGAAAGATGG - Intronic
1195439120 X:104882245-104882267 AGAAGAATTCAAATGATGGAAGG + Intronic
1195593971 X:106666806-106666828 AGAAAAATGGCTATGATGTAAGG - Intronic
1195763798 X:108275182-108275204 AGAAAAATGGAAATGAAGGAAGG + Intronic
1199195724 X:145027575-145027597 AGGGGAAAGCCTAAGAAGGAAGG + Intergenic