ID: 977605342

View in Genome Browser
Species Human (GRCh38)
Location 4:98978971-98978993
Sequence ATGTATCCTCACGTGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977605334_977605342 29 Left 977605334 4:98978919-98978941 CCAACAGATTCAGTGTCTGGTAA No data
Right 977605342 4:98978971-98978993 ATGTATCCTCACGTGGTGGAAGG No data
977605338_977605342 3 Left 977605338 4:98978945-98978967 CCTGCTAGTCATTGATGGTGCCT No data
Right 977605342 4:98978971-98978993 ATGTATCCTCACGTGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977605342 Original CRISPR ATGTATCCTCACGTGGTGGA AGG Intergenic
No off target data available for this crispr