ID: 977607521

View in Genome Browser
Species Human (GRCh38)
Location 4:98996804-98996826
Sequence GTGCCTCTCTTCACTAAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 99}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977607521_977607526 19 Left 977607521 4:98996804-98996826 CCAGGTTTAGTGAAGAGAGGCAC 0: 1
1: 0
2: 0
3: 6
4: 99
Right 977607526 4:98996846-98996868 ATTGGTAGCGTCCTGTGGGGAGG 0: 1
1: 0
2: 0
3: 4
4: 56
977607521_977607524 15 Left 977607521 4:98996804-98996826 CCAGGTTTAGTGAAGAGAGGCAC 0: 1
1: 0
2: 0
3: 6
4: 99
Right 977607524 4:98996842-98996864 TTAAATTGGTAGCGTCCTGTGGG No data
977607521_977607525 16 Left 977607521 4:98996804-98996826 CCAGGTTTAGTGAAGAGAGGCAC 0: 1
1: 0
2: 0
3: 6
4: 99
Right 977607525 4:98996843-98996865 TAAATTGGTAGCGTCCTGTGGGG 0: 1
1: 0
2: 0
3: 6
4: 51
977607521_977607527 27 Left 977607521 4:98996804-98996826 CCAGGTTTAGTGAAGAGAGGCAC 0: 1
1: 0
2: 0
3: 6
4: 99
Right 977607527 4:98996854-98996876 CGTCCTGTGGGGAGGAGAGCCGG No data
977607521_977607522 1 Left 977607521 4:98996804-98996826 CCAGGTTTAGTGAAGAGAGGCAC 0: 1
1: 0
2: 0
3: 6
4: 99
Right 977607522 4:98996828-98996850 TGAATATTCAAATATTAAATTGG 0: 1
1: 1
2: 7
3: 90
4: 961
977607521_977607523 14 Left 977607521 4:98996804-98996826 CCAGGTTTAGTGAAGAGAGGCAC 0: 1
1: 0
2: 0
3: 6
4: 99
Right 977607523 4:98996841-98996863 ATTAAATTGGTAGCGTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977607521 Original CRISPR GTGCCTCTCTTCACTAAACC TGG (reversed) Intronic
904224850 1:29008125-29008147 GTGGCACTATTCACTAAAACAGG - Intronic
904517061 1:31064934-31064956 GTGTCTCTCTTCACTCAAAGAGG - Intronic
904708985 1:32414219-32414241 GTGCCTCTCTACTAAAAACCAGG + Intergenic
911487886 1:98525485-98525507 GTCCCACTCTTCACTAATGCTGG + Intergenic
916889191 1:169100251-169100273 GTGCCTGTCTGCATTACACCAGG + Intergenic
922010027 1:221574027-221574049 GTGCAACTCTTCAATAGACCAGG + Intergenic
1068288764 10:54973947-54973969 GTGCCTTTATTTACTAAATCAGG + Intronic
1079334454 11:19559045-19559067 GTGTCTCTCTTCCTTAAATCTGG - Intronic
1079346702 11:19658922-19658944 GTACCTCTCTCCACTAGTCCTGG + Intronic
1079382855 11:19953879-19953901 GTGTCTTTCTCCACTAAACTTGG + Intronic
1081662170 11:44894800-44894822 GTGCTGCTCTTCCCTGAACCAGG - Intronic
1082747883 11:56986151-56986173 TTGCCACACTTCACTAAAACTGG + Intergenic
1083925127 11:65801477-65801499 GTGGCTCCCTGCACTGAACCTGG + Intergenic
1085725930 11:78954542-78954564 TTGCCTCTCTGCATTAAACAAGG - Intronic
1092959514 12:13582689-13582711 GTGCCTCTCTGAACTCAACGTGG + Intronic
1094435073 12:30412386-30412408 GTGCATCTCCTCACTTAAGCAGG + Intergenic
1101633739 12:106520232-106520254 GCTCCTCTCTTCCCTAATCCAGG - Intronic
1109953238 13:69530177-69530199 GTGCTTCTCTTCACTACACTAGG + Intergenic
1111259768 13:85721836-85721858 GTGCCTCACTACACAGAACCAGG - Intergenic
1117051535 14:51865256-51865278 GTGCCTGTCTTTACTAGATCTGG + Intronic
1118600873 14:67470816-67470838 GGGCCTCTCTCCACTAGACATGG - Exonic
1119115530 14:72017616-72017638 TTGCCTATCTTCACAAAACAGGG + Intronic
1119189315 14:72669610-72669632 CTGCCTCCCTTGGCTAAACCTGG - Intronic
1202847336 14_GL000009v2_random:191789-191811 GTGCCCCTTTTCACCATACCTGG - Intergenic
1202916801 14_GL000194v1_random:182347-182369 GTGCCCCTTTTCACCATACCTGG - Intergenic
1202875989 14_KI270722v1_random:849-871 GTGCCCCTTTTCACCATACCTGG + Intergenic
1125284577 15:38078293-38078315 GTGCATCTGTTCACCAAACATGG + Intergenic
1125497439 15:40210021-40210043 GTGCCTCTATCCCTTAAACCAGG + Intronic
1126127552 15:45309544-45309566 GTGCCTCTCTGGACTCAACAGGG + Intergenic
1126597543 15:50397375-50397397 GTGCCACTCTGCACTCCACCAGG + Intergenic
1131002488 15:88949928-88949950 GAGTCTCTCTTCCCTAAAGCAGG + Intergenic
1131779332 15:95839683-95839705 GTTCCTCTCTTCACTGATGCTGG - Intergenic
1132072723 15:98793542-98793564 GTGCTTCTCTATACTAAAACAGG + Intronic
1132913966 16:2331886-2331908 GAGGCTCTCTTCACTAGTCCCGG + Intronic
1133042381 16:3067538-3067560 CTGCCTCTCTTCACAGCACCAGG + Exonic
1133378572 16:5310464-5310486 GTGCCTGAGTTCACTATACCTGG - Intergenic
1144662228 17:17078583-17078605 GTTCTTCTGGTCACTAAACCAGG + Intronic
1145279570 17:21457809-21457831 GTGCCTCTCTGCCCTCACCCCGG + Intergenic
1145884330 17:28371954-28371976 GTCCCTCTTTTCCCAAAACCCGG + Exonic
1146069136 17:29663257-29663279 TTGCCTCTCTTTACTCAATCTGG + Intronic
1149565715 17:57639438-57639460 GTGCCACTCTTCTCAAACCCAGG + Intronic
1150064891 17:62100674-62100696 GCCACTCTGTTCACTAAACCTGG - Intergenic
1150461230 17:65355410-65355432 GTGACTCTTTTCACCAAACAAGG + Intergenic
1150858509 17:68776579-68776601 GTGCCTCTCTTAACAAGAGCAGG - Intergenic
1152204306 17:78966318-78966340 GTGCCTCTGTTCACCAGATCTGG - Intergenic
1153378781 18:4412201-4412223 GTCCCCCTCTTCACTAACACAGG - Intronic
1156037697 18:32784106-32784128 TTGCCTCTCATCACTCAACTGGG - Intergenic
1157661389 18:49448097-49448119 GTGCCTCTCTACTAGAAACCAGG + Intronic
1161830125 19:6596765-6596787 CTGCCTCTCTTCCATAACCCTGG + Intronic
1164770098 19:30801789-30801811 GTGCCTCTCTTCCCTCCTCCTGG + Intergenic
1202674672 1_KI270710v1_random:31961-31983 GTGCCCCTTTTCACCATACCGGG - Intergenic
927312715 2:21648849-21648871 GTGCCTCTCTTCACACAGCCTGG + Intergenic
938441607 2:131339829-131339851 ATGCCTCTCTCCACTCCACCAGG - Intronic
943353463 2:186822365-186822387 GTGGCTCTCTTCTATAACCCAGG + Intergenic
944385100 2:199155062-199155084 GTGCCTCCCTTCCCCAAACCAGG - Intergenic
944499657 2:200346040-200346062 TTGCCTCACTGAACTAAACCAGG - Intronic
946931818 2:224678581-224678603 GTGCCTCTGTTCACTTAACAAGG - Intergenic
948834870 2:240621012-240621034 GTTCCCCTCTTCACAGAACCAGG - Intronic
1171345673 20:24464364-24464386 GTGTCTCCCTTCCCAAAACCAGG - Intergenic
1174352875 20:49981072-49981094 ATTTCTCTCTTCACTAAACGAGG + Intergenic
1176637265 21:9258219-9258241 GTGCCCCTTTTCACCATACCTGG + Intergenic
1178788914 21:35680051-35680073 CTTCCTCTGTTCACTAGACCTGG + Intronic
1181522980 22:23459995-23460017 GTGCCACTCTTCACTGAGGCTGG - Intergenic
1182198639 22:28545534-28545556 GTGCCACTCTTCTCTAGCCCAGG + Intronic
954032208 3:47827651-47827673 GTGTTCCTCTTCCCTAAACCAGG - Intronic
955429072 3:58823059-58823081 TTTCCTCTCTTCATCAAACCTGG + Intronic
955839736 3:63099130-63099152 GTTCCTCTTTTTGCTAAACCTGG - Intergenic
963406348 3:144868468-144868490 GTTCAACTCTTCACTGAACCAGG - Intergenic
965170049 3:165251383-165251405 GTGCCCTTCTTCCCTGAACCAGG - Intergenic
1202749629 3_GL000221v1_random:146800-146822 GTGCCCCTTTTCACCATACCTGG - Intergenic
968835482 4:2961612-2961634 GTGCCACACTTCACCATACCGGG + Intronic
969263380 4:6047538-6047560 GTTCCTATCATCACTAAACCTGG - Intronic
974229726 4:59094296-59094318 GTGCCTCTTCTCAGTAAACATGG + Intergenic
975798314 4:78032481-78032503 GTGCCTCTCCTCTGTCAACCAGG + Intergenic
976194042 4:82516040-82516062 TTGTTTCTCTTCACTGAACCAGG - Intronic
977607521 4:98996804-98996826 GTGCCTCTCTTCACTAAACCTGG - Intronic
980642303 4:135596462-135596484 GTGCCTCTCTACTGGAAACCAGG + Intergenic
984397602 4:179221364-179221386 GTGCCTCTCATCTGTGAACCAGG + Intergenic
984706564 4:182851369-182851391 GTGCCTCACTTCATTTCACCAGG - Intergenic
1202752157 4_GL000008v2_random:16646-16668 GTGCCCCTTTTCACCATACCTGG + Intergenic
985646300 5:1086203-1086225 GTGGCTCTCTTCAGGAACCCAGG + Intronic
987313064 5:16699179-16699201 CTGCCACTCTGCACCAAACCAGG + Intronic
988420342 5:30998361-30998383 TTGCCTCTCTTTATTCAACCCGG + Intergenic
991001468 5:61787795-61787817 GTGGCTCTCTTGATTAGACCAGG - Intergenic
998573729 5:143290608-143290630 GTGCCACTCTTCTCCAAACTGGG - Intronic
999823264 5:155249749-155249771 GTGATTCTCTTCCCTAGACCAGG + Intergenic
1001004905 5:168041615-168041637 GTGCCTCTGAACCCTAAACCTGG + Intronic
1019588348 7:1816556-1816578 GTGCCACTCTTCACTGAGGCTGG + Intronic
1026512004 7:71035153-71035175 GTGTCTCTCTCTACTAAGCCTGG - Intergenic
1041279593 8:56197195-56197217 GTGCCTCTCTCCCCAAATCCTGG + Intronic
1042038772 8:64568739-64568761 GTGCCTGTATTCACTAAACAAGG + Intergenic
1046376129 8:113383479-113383501 TTGCCTCTTTCCACTCAACCAGG - Intronic
1046481725 8:114828459-114828481 GTCCGTCTCATCACAAAACCTGG + Intergenic
1047750381 8:127876046-127876068 GTAACTCTGTTCAGTAAACCTGG - Intergenic
1050009865 9:1174283-1174305 GTTCCTGTCTTCACTAAGACAGG + Intergenic
1059622374 9:116021197-116021219 GTGCTGCTCTTCCCCAAACCAGG + Intergenic
1061388233 9:130302974-130302996 GTGCCTCTCTTCGCCCAGCCTGG - Intronic
1203718272 Un_KI270742v1:176888-176910 GTGCCCCTTTTCACCATACCTGG - Intergenic
1203532943 Un_KI270743v1:1334-1356 GTGCCCCTTTTCACCATACCTGG + Intergenic
1203652490 Un_KI270751v1:140581-140603 GTGCCCCTTTTCACCATACCTGG - Intergenic
1190940265 X:55033341-55033363 GTGCCTCTCTGTACTATTCCTGG + Intergenic
1192235374 X:69292161-69292183 GGGCCCCTCTTCACTATTCCTGG - Intergenic
1195044287 X:101042210-101042232 GTGGGTCTCTTCTCCAAACCAGG - Exonic
1197356167 X:125439252-125439274 GTGCCTCTCTACTAGAAACCAGG - Intergenic
1200370381 X:155719026-155719048 GTGCCTCTTTCAGCTAAACCAGG - Intergenic
1201172427 Y:11281738-11281760 GTGCCCCTTTTCACCATACCTGG - Intergenic