ID: 977609519

View in Genome Browser
Species Human (GRCh38)
Location 4:99017793-99017815
Sequence TGGCATTGGCTGCCACAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 182}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977609515_977609519 11 Left 977609515 4:99017759-99017781 CCAAAGGTAATCTTTCTGCTTTC 0: 1
1: 0
2: 11
3: 56
4: 403
Right 977609519 4:99017793-99017815 TGGCATTGGCTGCCACAGACTGG 0: 1
1: 0
2: 1
3: 22
4: 182
977609513_977609519 13 Left 977609513 4:99017757-99017779 CCCCAAAGGTAATCTTTCTGCTT 0: 1
1: 0
2: 6
3: 40
4: 269
Right 977609519 4:99017793-99017815 TGGCATTGGCTGCCACAGACTGG 0: 1
1: 0
2: 1
3: 22
4: 182
977609514_977609519 12 Left 977609514 4:99017758-99017780 CCCAAAGGTAATCTTTCTGCTTT 0: 1
1: 0
2: 6
3: 46
4: 393
Right 977609519 4:99017793-99017815 TGGCATTGGCTGCCACAGACTGG 0: 1
1: 0
2: 1
3: 22
4: 182
977609512_977609519 14 Left 977609512 4:99017756-99017778 CCCCCAAAGGTAATCTTTCTGCT 0: 1
1: 0
2: 8
3: 58
4: 274
Right 977609519 4:99017793-99017815 TGGCATTGGCTGCCACAGACTGG 0: 1
1: 0
2: 1
3: 22
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977609519 Original CRISPR TGGCATTGGCTGCCACAGAC TGG Intronic
900876372 1:5345578-5345600 TGGCAATGCCTACCACAGAGAGG - Intergenic
902980381 1:20118466-20118488 TACCCTTGGCTGCCACTGACAGG + Intronic
906103040 1:43275279-43275301 AGGTATGGGCAGCCACAGACAGG - Intergenic
907401214 1:54226104-54226126 TGGGAGAGGCTGCCACTGACAGG - Intronic
907586045 1:55618869-55618891 TCACATTGGCTTCCACACACTGG - Intergenic
908102615 1:60807410-60807432 TGGCAGTGGCTACCATAGGCTGG + Intergenic
908551599 1:65214054-65214076 TTGCTAGGGCTGCCACAGACTGG - Intronic
909512745 1:76473350-76473372 TGGCATTTGCTTCCACAGGTGGG + Intronic
915130617 1:153693251-153693273 TGGCATTGGCTGCTTGAGAAGGG - Intronic
915620116 1:157076796-157076818 TGCCTTTGGCTGGCTCAGACGGG - Intergenic
919043758 1:192425109-192425131 TAACATTGGCTGCAACAGTCTGG - Intergenic
919474764 1:198019856-198019878 TGGCAGTGGATGGCATAGACTGG - Intergenic
921470890 1:215547825-215547847 TGCCATTGGCTGACACAAATTGG + Intergenic
922132937 1:222796832-222796854 TGGCATTGGCTTTAAAAGACGGG - Intergenic
1066231086 10:33433876-33433898 TGGCATTTACTGCCAAATACTGG - Intergenic
1069944365 10:71975728-71975750 TGGCATCTGCGCCCACAGACAGG - Intronic
1071064426 10:81614126-81614148 TGGCATGGGCTTCCACAAACAGG + Intergenic
1075240328 10:120772768-120772790 TGGCATTGGCTCCCAGAGACTGG + Intergenic
1075632323 10:124008021-124008043 TGGCATTGAGTGGCACAGAAGGG + Exonic
1075738388 10:124678266-124678288 GTGCATTGGCTGGCACAGGCCGG - Intronic
1076130310 10:128009494-128009516 TGGCACTGGCTGGCACACAGGGG - Intronic
1076132875 10:128025948-128025970 TGGCTCTGGCTGCCAAAGAAAGG - Intronic
1088443595 11:109899806-109899828 TGTCATTTGCTGCAACAGAGAGG + Intergenic
1089383821 11:118055223-118055245 TGGCCTTGGCAGCCACAAACAGG - Intergenic
1089945058 11:122462008-122462030 TGGCATTGGTGGCCATAGCCTGG - Intergenic
1100436392 12:94575167-94575189 GGGAATGGGCTGCCAGAGACAGG - Intronic
1100676913 12:96878359-96878381 TGGGATAGGATGCCACAGAAGGG - Intergenic
1100705050 12:97191543-97191565 TGGCATTTGGTGCCACAATCTGG - Intergenic
1101076367 12:101133552-101133574 TGACATGGGCTGCCACAGAAAGG - Intergenic
1102163116 12:110785465-110785487 TGGCCATGGCTGCCCCAGTCAGG + Intergenic
1104915474 12:132262249-132262271 AGGCACTGGCAGCCACACACTGG + Intronic
1105291767 13:19058020-19058042 TGGCATTGCCTGGCTCAGGCTGG - Intergenic
1105330285 13:19409710-19409732 TGGCATTGTCTGCCTCACTCGGG + Intergenic
1106500657 13:30325393-30325415 TGGCAGTGGCAGCCACAGCATGG + Intergenic
1106529510 13:30576634-30576656 TGGCAGTGGAAGCCACAGGCTGG - Intronic
1107339395 13:39389656-39389678 TGCCACTGTCTGCCACACACCGG - Intronic
1108035317 13:46285057-46285079 TGTCACTGTCTGCCAGAGACAGG + Intergenic
1108252342 13:48579659-48579681 TGGCACTGGCTGACACAAAATGG - Intergenic
1109563438 13:64078988-64079010 TGGCAGTGGCTGCTCAAGACAGG + Intergenic
1110987370 13:81987446-81987468 TGGCATTGCCTGCCTAATACAGG - Intergenic
1113787630 13:113010790-113010812 TGGCCTTGGGTGGCACATACGGG + Intronic
1114141616 14:19917725-19917747 TGCCTTTTGCTGCCACAGTCAGG - Intergenic
1114155486 14:20099128-20099150 TGGCATTGGCCAGCCCAGACAGG - Intergenic
1118248415 14:64134508-64134530 TGGCATTCACTTCCAGAGACAGG - Intronic
1122679148 14:103443692-103443714 TGTCACTGGTTGCCACAGGCTGG - Intronic
1123893388 15:24803383-24803405 TGGCATTGGCTGCCACTGTGGGG - Intergenic
1124645247 15:31433821-31433843 TGGCCTCGGCTGCCAGGGACTGG - Intronic
1125139730 15:36390752-36390774 TGGCAGTGTCTGCTACAGCCTGG - Intergenic
1125381755 15:39093117-39093139 AGGCACTGGCTGCAACAGAGAGG - Intergenic
1125681195 15:41531284-41531306 TGTCCTTGGCACCCACAGACAGG - Intronic
1126549347 15:49909344-49909366 TGGCAGTGGCTGTGACAGGCTGG - Intronic
1127070556 15:55284590-55284612 TGGCTTTGGCTGCCACATGTTGG + Intronic
1129183404 15:73891392-73891414 TGGCAGTGGCTGCTCCAGATGGG - Intergenic
1129693665 15:77728424-77728446 TGGGAGTGGGTGCCACACACAGG + Intronic
1130443723 15:83979187-83979209 TAGCAGTGGCTGCTACAGATCGG - Intronic
1130901788 15:88212790-88212812 TGCCAATGGCAGCCACAGAGTGG - Intronic
1132509184 16:328779-328801 TGGCAACGGGTGCTACAGACAGG + Intronic
1133263431 16:4568031-4568053 TGCCAATGGCTCCCATAGACAGG - Intronic
1133449226 16:5889694-5889716 TAGCATGGGCTGCCACGGACAGG - Intergenic
1136022112 16:27446883-27446905 TGGGAGTGGCTGCCACAGAGAGG + Intronic
1137375617 16:47949460-47949482 TGGCATTGGCCACCATGGACTGG - Intergenic
1139063788 16:63288605-63288627 TGGAAGTGGCTGTCACATACAGG + Intergenic
1140990828 16:80209742-80209764 TCTCATTGGCTGGTACAGACTGG - Intergenic
1141398555 16:83726430-83726452 TGGCAATGGCTGCAGCAGAAGGG - Intronic
1144355803 17:14445080-14445102 TGGCATTGGCTACTCTAGACTGG + Intergenic
1149330710 17:55578015-55578037 TGGCAGCGGCTGCCCCAGATGGG + Intergenic
1150982425 17:70157386-70157408 GGGCATCTGCTGCCACAGAGAGG - Intergenic
1151692310 17:75694123-75694145 TGGTAATGGTTGCCACAGAGAGG - Intronic
1152295986 17:79467169-79467191 TGGCACGGGCTGCTGCAGACGGG + Intronic
1152639426 17:81443500-81443522 TGCCGTAGGCTGCCTCAGACCGG - Exonic
1152685637 17:81692525-81692547 GGGCAGTGGCTGCGACGGACGGG - Intronic
1203194210 17_KI270729v1_random:216773-216795 TGGCATTGCATGCAACGGACTGG + Intergenic
1203203572 17_KI270730v1_random:16199-16221 TGGCATTGCATGCAACGGACTGG + Intergenic
1154163895 18:11999697-11999719 TGGGAATGGCTGCCACAGCCGGG + Intronic
1154411538 18:14144615-14144637 TGGCTCTGGCTGCCTCAGCCTGG + Intergenic
1155168113 18:23247454-23247476 TGGCACTGGCTGCCAGATCCTGG - Intronic
1156007661 18:32462893-32462915 TAGCAGTGGCTACCAGAGACTGG + Intronic
1157543626 18:48531689-48531711 TGGGAGTGGCTCCCACAGTCTGG + Intergenic
1159705011 18:71675284-71675306 CTGCATTGGCTGCTCCAGACGGG + Intergenic
1162778005 19:12991365-12991387 TGGCATGGCCTGACACACACAGG + Intergenic
1163322130 19:16581052-16581074 TGGCAGTGGCTGCCTCCCACTGG - Intronic
1164289367 19:23853534-23853556 TGGCATTGGCTGCCATTAAAAGG + Intergenic
1166897266 19:46032077-46032099 TGGCAGTGGCAGCTCCAGACGGG - Intergenic
1168627376 19:57930048-57930070 TGGCAATTCCTGCCACAGGCAGG + Intronic
927114281 2:19886034-19886056 TGGCACTGCCTGCCACATCCAGG + Intergenic
927458867 2:23280312-23280334 TGGCAATGGCTCCAACAGAGGGG + Intergenic
927569403 2:24144990-24145012 TGGCAGTGGCTACAACAGGCTGG - Intronic
927685261 2:25166231-25166253 TGGCACTGGCAGCCAGTGACTGG + Intronic
929699178 2:44147187-44147209 GGGCATTTGCTACCACAGACTGG + Intergenic
929793737 2:45042271-45042293 AGGCTTTGTCTGCCACAGACTGG + Intergenic
930916524 2:56696671-56696693 TGAAATTGTCAGCCACAGACTGG + Intergenic
931693246 2:64852982-64853004 GGGCATTTCCTCCCACAGACTGG + Intergenic
933171947 2:79134428-79134450 TGGTCTTGGCGGCCACCGACAGG + Intergenic
933374970 2:81467433-81467455 CGGCCTTGGCTGCCACAGCTAGG + Intergenic
937342639 2:121101065-121101087 TGGCGGTGGCTCCCACAGAGAGG + Intergenic
939070412 2:137533720-137533742 TAGCCTGGGCTGCCACTGACAGG + Intronic
941324626 2:164098287-164098309 AGGCAATGGCTGACACAGCCAGG + Intergenic
941936660 2:170987034-170987056 TGGCATGGGCTGCGACAAAATGG - Intergenic
941979682 2:171441275-171441297 TGGCATTGACTCCCACAACCAGG - Intronic
944146613 2:196513913-196513935 TGGCAGTGGCTGCACCAGATGGG - Intronic
945789999 2:214293287-214293309 TGTCAGTGGCTGCAACAGGCTGG + Intronic
948058458 2:235026848-235026870 AGGCATGGGCAGCCACCGACAGG - Intronic
1169307441 20:4504470-4504492 TTGCATTGTGTGCCACACACAGG - Intergenic
1169632470 20:7648119-7648141 TGGCAGTGGCTGCTCCAGATAGG + Intergenic
1170240819 20:14164574-14164596 TGGCAGTGGCTGTGACAGGCTGG + Intronic
1172184337 20:33021879-33021901 TGGTTTTGGCAGCCACAGAGGGG - Intronic
1173230442 20:41192126-41192148 TGGCAGTGGCTGCAACAGGCTGG + Intronic
1173470694 20:43321176-43321198 TTGCAGGGGCTGCCCCAGACCGG + Intergenic
1174415090 20:50360939-50360961 AGGCATTGCCTGACACAGGCTGG + Intergenic
1175544275 20:59768194-59768216 TGGAATTGACTGCTACAAACAGG + Intronic
1176861517 21:14013809-14013831 TGGCTCTGGCTGCCTCAGCCTGG - Intergenic
1178217272 21:30613769-30613791 TGGCTGTGGCTTCCGCAGACTGG - Exonic
1178478385 21:32957405-32957427 TCGCATTGGCAGCCAGAGCCAGG + Intergenic
1178701842 21:34840619-34840641 TGGCAGTGGCTCCCGCAGCCAGG - Intronic
1180096281 21:45556676-45556698 TGGCCGGAGCTGCCACAGACAGG + Intergenic
1180107031 21:45625863-45625885 TGGCCCTGGCTGCCACAGCAGGG - Intergenic
1180564604 22:16652117-16652139 TGGCATTGTCTGCCTCACTCGGG - Intergenic
1182148671 22:28013479-28013501 TTGCATAATCTGCCACAGACAGG - Intronic
949238478 3:1840540-1840562 TAGCATTGTCTACCACATACAGG - Intergenic
950663499 3:14481447-14481469 TGGCACTGGGAGCCACAGAAGGG + Intronic
952956071 3:38558269-38558291 TGGCATTGTCTGCCCTAGTCTGG + Intronic
954514738 3:51163313-51163335 TGGCCTTGGCAGAGACAGACAGG - Intronic
955191563 3:56766456-56766478 TGGCAGTGGCTGCCAGTGATGGG - Intronic
960062613 3:113339636-113339658 TGGCTTTGGATCCCTCAGACCGG + Intronic
961042770 3:123689023-123689045 TGGCAGTGCCTGGCACAGAGTGG + Intronic
962376598 3:134863488-134863510 TGGCATTTGCTGCCACTTAAGGG - Intronic
965114920 3:164477213-164477235 TGGCAGTGGTTGCTCCAGACAGG - Intergenic
967635829 3:191801750-191801772 TGGCAGTGGCTGTGACAGGCTGG - Intergenic
968968301 4:3780645-3780667 TGGCATTGCATGTCACAGGCTGG - Intergenic
973232474 4:47857747-47857769 TGGCACAGGCAGCCACAGTCAGG - Intronic
973636113 4:52862920-52862942 TGGCAATGCCTGGCACAGAAAGG + Intronic
974250445 4:59377384-59377406 TGGCTTTGGATCCCTCAGACCGG + Intergenic
976097948 4:81528660-81528682 TGGCAGTGGCTGCTCCAGACAGG + Intronic
977609519 4:99017793-99017815 TGGCATTGGCTGCCACAGACTGG + Intronic
977926522 4:102705957-102705979 TGACAGTGGCTGCAACAGGCTGG - Intronic
978248709 4:106604908-106604930 TGGCAATGGCTGCTCCAGATGGG + Intergenic
980671012 4:136008098-136008120 TGGCAGTGGCGGCCCCAGGCAGG - Intergenic
985714385 5:1447045-1447067 TGTCAGTGGCTGCCACAGAAGGG + Intergenic
985924673 5:3006522-3006544 TGGCGCTGGCTGCCACTGAGAGG + Intergenic
986254346 5:6089332-6089354 TGGCATTATAGGCCACAGACGGG - Intergenic
986452698 5:7882024-7882046 TGGCACTGACTGTCACAGGCTGG + Intronic
991564744 5:67993115-67993137 TGGCAATGGTTCCCACAGAGAGG + Intergenic
997949400 5:138230274-138230296 TGTCATTTGCTGCCTCAGATAGG + Intergenic
998011138 5:138696640-138696662 CCTCATTGGCTGCCACAGAAGGG - Intronic
998480664 5:142459856-142459878 TGGCAGTGGCTGCTCCAGACAGG + Intergenic
999128537 5:149264983-149265005 TGGCCTTCTCTGCCACAGATTGG + Intergenic
999436492 5:151567477-151567499 TGGCTGTGACTGCCACTGACCGG - Exonic
1000105826 5:158057967-158057989 TGACAGTGTCTGCCACACACAGG - Intergenic
1000870638 5:166573099-166573121 AGGCAGTGGCTTCCAAAGACTGG + Intergenic
1001692822 5:173645642-173645664 TGGCATGTGCTGACACAGAAGGG + Intergenic
1002078722 5:176725371-176725393 AGCCATTAGCTGCCACAGTCAGG - Intergenic
1002332690 5:178455380-178455402 TGGCATCGGCTGACACAGCAGGG + Intronic
1005260469 6:24053394-24053416 TGGTCTTGGCTGCCACTGAGTGG - Intergenic
1007231321 6:40349348-40349370 TGGTGTTGGCTGCCACAGCCGGG - Intergenic
1007312624 6:40958691-40958713 TGACAGTGGCTGCCACCGATAGG + Intergenic
1007621128 6:43215289-43215311 TCGCTCTGGCTGCCACAGAAAGG - Exonic
1007741645 6:44013423-44013445 TGGCATTGGGTGCCCCAGGCCGG + Intergenic
1009905106 6:69860330-69860352 TTGCATTGGCTGCCAGACAATGG - Intergenic
1019442800 7:1055936-1055958 TGGCTTTGGCTGTCACAGAGTGG - Intronic
1021471107 7:21003203-21003225 AGGCACTGGCTGCAGCAGACAGG - Intergenic
1023700190 7:42884182-42884204 TGGCAGTGGCTGCTTCAGGCAGG + Intergenic
1024024406 7:45399132-45399154 TCGCAGTGGCTGCTCCAGACGGG - Intergenic
1026392167 7:69912463-69912485 TGGCAGCGGCTGCTCCAGACAGG + Intronic
1028640650 7:93039296-93039318 TGGCAGTGGCTGCTCCAGACAGG - Intergenic
1029199920 7:98832364-98832386 TGGCATTGGATGGCACAGCTCGG - Intergenic
1030243677 7:107359005-107359027 TGGCAGTGGCTGCTCCAGAGAGG - Intronic
1031128894 7:117807973-117807995 TGGCAATAGATGCCTCAGACAGG - Intronic
1031172595 7:118310085-118310107 TGGCATTGACTGAAATAGACAGG - Intergenic
1032702709 7:134396625-134396647 TGGCATGGGATGGCACAGAATGG - Intergenic
1032858918 7:135859231-135859253 TGGCAGTGGCTGCTTCAGACAGG + Intergenic
1034381775 7:150702167-150702189 TCCCATTGGCTGTCAGAGACAGG - Intergenic
1035608410 8:944717-944739 AGGGATTGGCTGCCACTGACTGG - Intergenic
1035608444 8:944876-944898 AGGGTTTGGCTGCCACTGACTGG - Intergenic
1035817602 8:2557840-2557862 GAGCATTGTCTGCCACAGATGGG - Intergenic
1036777481 8:11623590-11623612 TGGCATTGGATGGACCAGACAGG - Intergenic
1037741830 8:21614575-21614597 TTGCAGTGTCTGCCGCAGACAGG - Intergenic
1038226711 8:25664293-25664315 TGGCATTGGCTGCATCACATAGG + Intergenic
1040933232 8:52756711-52756733 TGGCAGTGGCTGTGACAGGCTGG - Intergenic
1043304047 8:78771815-78771837 TAGCAGTGGCTGCAACAGAAAGG - Intronic
1043867745 8:85395042-85395064 TGGAATCGACTGCCCCAGACAGG - Intronic
1046264993 8:111819120-111819142 TGGTATTAGCTGTCACAAACTGG + Intergenic
1049483731 8:142840473-142840495 TGGCACTGGCTGCCACCAATGGG - Exonic
1052652530 9:31321996-31322018 TGGCAGTGGCTGCTCCAGATGGG + Intergenic
1053388391 9:37714488-37714510 AGGCACTGGTGGCCACAGACTGG - Intronic
1055309604 9:74964770-74964792 TGGCAGTGGCTGTGACAGGCTGG - Intergenic
1056803168 9:89708239-89708261 CGCCATAGGCTGGCACAGACTGG + Intergenic
1057268593 9:93634570-93634592 TGGCATTGCCTGGCTCAGGCTGG + Intronic
1057809975 9:98250308-98250330 TGGCATTGGATGGCAGTGACCGG + Intronic
1057895635 9:98906657-98906679 TGGCATTTGCTGACTCAGAGAGG + Intergenic
1057964351 9:99488727-99488749 TATCATTTGCTGCCACAGAAGGG + Intergenic
1059053404 9:110953037-110953059 TGACAGTGGCTGCAACAGGCTGG - Intronic
1059280776 9:113131850-113131872 TCACACTGGCTGCCTCAGACAGG + Intergenic
1060898684 9:127238292-127238314 TGGCTGTGGCTGCCACAGCTAGG + Intronic
1061388626 9:130304941-130304963 TGGCATTGCTGGCCACACACTGG - Intronic
1061696466 9:132379002-132379024 TGGCATTTGGTGCCACATGCTGG - Intronic
1062328990 9:136028535-136028557 TGGCAGTGGCTGGTCCAGACGGG - Intronic
1062331622 9:136047431-136047453 TGGCTCTGGATGCCACAGTCTGG - Intronic
1185972280 X:4678606-4678628 GGGCATTTGCTACCACATACAGG + Intergenic
1186807531 X:13155080-13155102 TGGAAGTGGCTGCCTCAGACTGG + Intergenic
1187994583 X:24912416-24912438 AGGCAATGACTGCCACAGACTGG + Intronic
1188067445 X:25679443-25679465 TGGCACTGGCTTCTTCAGACTGG + Intergenic
1188743904 X:33817874-33817896 CTGCATGGGCTGCCACACACTGG - Intergenic
1190457350 X:50639124-50639146 TTGCACTGACTGCCACATACAGG + Intronic
1190924994 X:54894849-54894871 TGGCAGTGGCTGCAACAGGCTGG - Intergenic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1199136226 X:144255823-144255845 TGGCAGTGTCTGAGACAGACTGG - Intergenic