ID: 977615426

View in Genome Browser
Species Human (GRCh38)
Location 4:99083097-99083119
Sequence CTGCAGTTTTGCAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 377}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977615421_977615426 23 Left 977615421 4:99083051-99083073 CCTGGCTTATATATCCACTTACA 0: 1
1: 0
2: 0
3: 19
4: 155
Right 977615426 4:99083097-99083119 CTGCAGTTTTGCAGGGAAGATGG 0: 1
1: 0
2: 4
3: 39
4: 377
977615422_977615426 9 Left 977615422 4:99083065-99083087 CCACTTACAACGTAACAATCTTT 0: 1
1: 0
2: 0
3: 5
4: 92
Right 977615426 4:99083097-99083119 CTGCAGTTTTGCAGGGAAGATGG 0: 1
1: 0
2: 4
3: 39
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977615426 Original CRISPR CTGCAGTTTTGCAGGGAAGA TGG Intronic
900034227 1:393538-393560 CGGCTGTTCTGCAGGGAAGGAGG - Intergenic
900055062 1:623428-623450 CGGCTGTTCTGCAGGGAAGGAGG - Intergenic
900176833 1:1294817-1294839 CTGCAGGTCCGCAGGGAAGGGGG + Intronic
901265294 1:7905624-7905646 CTGCAGTGTTCCAAGGAAGAGGG + Intergenic
902070983 1:13737430-13737452 TTGCAGTTTTGCAGGCCATATGG - Intronic
902671924 1:17980504-17980526 CTGCAATGTTGCAGGGAAGGCGG + Intergenic
903011355 1:20332875-20332897 CAGCCGTTCTCCAGGGAAGAGGG - Exonic
904033298 1:27546527-27546549 CTGCAGGTTTGCAGGGACAGTGG + Intronic
905664830 1:39756832-39756854 ATGCAGTTTTGGAGGAAAGTGGG - Intronic
905807447 1:40887111-40887133 AAGCAGGTCTGCAGGGAAGAGGG + Intergenic
905966778 1:42104896-42104918 CTGCAGTTTGAGAGGGGAGAAGG - Intergenic
906830553 1:49027127-49027149 CGGTTGTTTTGCTGGGAAGAAGG - Intronic
908175134 1:61547753-61547775 ATGCAGGTTTTCAGGGAAGTGGG + Intergenic
908390293 1:63677792-63677814 CTTCAGTGTTGCTGGGAACAAGG + Intergenic
908667605 1:66510185-66510207 CTGCAGTTTTGGGAGGGAGAAGG - Intergenic
908748653 1:67399179-67399201 ATGCAGTTTTTCGGGGGAGAAGG + Intergenic
910291335 1:85602971-85602993 CTGTAGTTTTGCAGGCTAGAAGG + Intergenic
910471699 1:87560243-87560265 GTGCAGCTTTGCTGGGAAGAGGG - Intergenic
911840890 1:102680493-102680515 CTGCCTTTATGCAGAGAAGAAGG - Intergenic
912478297 1:109957151-109957173 AGGCAGTGTTGCTGGGAAGAAGG + Intergenic
914228087 1:145738701-145738723 CTGGAGCTTAGGAGGGAAGAAGG - Exonic
915419818 1:155771129-155771151 GGGCAGTTTTGCAGGTTAGAAGG + Exonic
916850737 1:168700768-168700790 CTGCAGTTTTGGCTGGAAAATGG - Intronic
917901473 1:179547208-179547230 CTGCAGTTTTGCAGGTATGCAGG - Intronic
918809274 1:189094381-189094403 GTGGAGTTTGGCAGGGGAGACGG + Intergenic
920207778 1:204305444-204305466 CTGCAATCCTGTAGGGAAGATGG - Intronic
920671888 1:208010001-208010023 GTACAGATTTGCAGGGAGGAGGG + Intergenic
920773765 1:208915307-208915329 ATGAAGGTCTGCAGGGAAGAAGG + Intergenic
921488512 1:215745178-215745200 CTTGAGTTTTGGAGTGAAGAAGG - Intronic
921794176 1:219323705-219323727 AGGCAGTTTAGAAGGGAAGAGGG + Intergenic
921929544 1:220743881-220743903 CTTCAGCTTTGAAAGGAAGATGG - Intergenic
922256583 1:223897707-223897729 CGGCTGTTCTGCAGGGAAGGAGG - Intergenic
922478430 1:225922624-225922646 CAGAAGATTGGCAGGGAAGAAGG - Intronic
923276011 1:232396986-232397008 CTGGAGATTTTCAGGGAATAAGG - Intergenic
923361162 1:233212539-233212561 ATGCAGTTGTCCAGGGAAGAGGG + Intronic
923771660 1:236942836-236942858 TTTCAGTTTTTCAGGGGAGAGGG + Intergenic
924547276 1:245041492-245041514 TTGCAGTGGTGCAGGCAAGAGGG + Intronic
1064085635 10:12344351-12344373 ATGCAGTTGCTCAGGGAAGACGG - Intergenic
1068110789 10:52678520-52678542 CTGCAAGTTTGCGGGGAAAAGGG + Intergenic
1068583081 10:58765040-58765062 CTGCAGTTTTGTAGGTAGTATGG + Intronic
1069771505 10:70903459-70903481 CAGAAGTGTTGCAGGGAAGGCGG - Intergenic
1069920403 10:71812457-71812479 CTGCAGTTGGGGAGGGAAAAGGG - Intronic
1070007074 10:72435140-72435162 CAGCACTTTTGGAGGGAAGGTGG + Intronic
1070278433 10:75030265-75030287 CTGCAGTTTGGCAAGGCTGAAGG - Exonic
1070820564 10:79351696-79351718 CTACAGTGTCGCAGGGAGGAAGG - Intronic
1071417206 10:85452394-85452416 TTTCAGTGTGGCAGGGAAGATGG - Intergenic
1072106735 10:92281340-92281362 CTGCACTTTGGGAGGCAAGATGG - Intronic
1074226272 10:111487622-111487644 GTGGGGGTTTGCAGGGAAGATGG - Intergenic
1074259122 10:111834195-111834217 CTGCACTTTTGGATGAAAGATGG + Intergenic
1075055438 10:119214988-119215010 CTGCAGTTCTGGAGTGAAGACGG + Intronic
1075540367 10:123307697-123307719 CTGTAGTTTTCCTGAGAAGAAGG + Intergenic
1076306535 10:129469124-129469146 CTGTCCTTTTGCAGGGAAGAAGG + Intronic
1076877034 10:133221002-133221024 CTCCAGATTTGCAGAGAAGGAGG - Intronic
1077172564 11:1174481-1174503 ATGCAGTTCTGCAGGGAAGGGGG - Intronic
1077503157 11:2918263-2918285 CTGCAGGTGTGCAGTGTAGAGGG - Intronic
1077549389 11:3193361-3193383 CTGGCGTTGTGCAGGGAAGGGGG - Intergenic
1077553309 11:3213786-3213808 CAGCAGCAATGCAGGGAAGAGGG - Intergenic
1078012556 11:7584110-7584132 CTGTAGTATTACAGGGAATAAGG - Intronic
1078602638 11:12747264-12747286 TTGCAGTATAGCAGGGAAGAAGG + Intronic
1079275971 11:19038062-19038084 CTGGAGTAATCCAGGGAAGAAGG - Intergenic
1079710833 11:23680424-23680446 CTGCAGCTATGAAGGGAAGTGGG + Intergenic
1080567559 11:33525849-33525871 ATACAGGTTTCCAGGGAAGAGGG - Intergenic
1081588803 11:44406751-44406773 CTGCAGTTCAGCACAGAAGACGG + Intergenic
1081678951 11:44988404-44988426 CTTCAGCTTGGCAGGGAAGGGGG + Intergenic
1081842031 11:46209516-46209538 CTGAAGCTTGGCAGAGAAGATGG + Intergenic
1082274017 11:50201944-50201966 GGGTAGGTTTGCAGGGAAGATGG - Intergenic
1082903887 11:58285329-58285351 CTGCAGGTTGTCAGGGAAGTGGG - Intergenic
1083065501 11:59919636-59919658 CAGCAGTTTAGCAGAGAACAAGG + Intergenic
1083562111 11:63681359-63681381 CTGCGCTCTTGCAGGGAAGGAGG - Intergenic
1083711509 11:64552538-64552560 GTGCATTTTTGCAGGGAGGGAGG - Intergenic
1083892751 11:65604930-65604952 CTCCAGCATTGCAGGGAGGAGGG - Intronic
1084537060 11:69763536-69763558 TTGCAGTTCTGGAGGGCAGAAGG - Intergenic
1085958170 11:81426883-81426905 CTGCAGGTTTGCAGGAAGCATGG + Intergenic
1086032890 11:82382269-82382291 CTGCAGTATGGCAGTGTAGAAGG + Intergenic
1086299003 11:85404036-85404058 CTACAGATTTGCAGAGTAGAGGG + Intronic
1086329486 11:85739277-85739299 CTGCAGTTTTGCAAATAACATGG - Intronic
1086577808 11:88360789-88360811 CTGCATTTGAGCAAGGAAGAAGG + Intergenic
1086642755 11:89179987-89180009 CTGCAGTTTTGAAATGTAGATGG + Intronic
1086701234 11:89902093-89902115 CTGCAGTTCTGGAGGGCACAGGG + Intergenic
1086704933 11:89942434-89942456 CTGCAGTTCTGGAGGGCACAGGG - Intergenic
1087002084 11:93431380-93431402 CTGGAGCTTAGAAGGGAAGAGGG + Intronic
1088179455 11:107092619-107092641 ATGCAGTTTGTCAGGGAAGTAGG - Intergenic
1088678147 11:112216214-112216236 TTGCAGGTTTGGAGAGAAGATGG + Exonic
1088698757 11:112392787-112392809 GTGCAGTTTTCCAGGGTTGAGGG - Intergenic
1088825991 11:113495197-113495219 CAGCAGTTTTACAGTGAGGAAGG - Intergenic
1089077926 11:115753523-115753545 CTGCAGTATATCAGGGGAGAGGG + Intergenic
1089958885 11:122598429-122598451 CTGCAGGTTTGCAGGGAACGGGG + Intergenic
1091686441 12:2566199-2566221 CTTCAGTTCTCCCGGGAAGAGGG - Intronic
1092951404 12:13507039-13507061 ATTCAGTTTTACAGGCAAGAGGG - Intergenic
1093028316 12:14264855-14264877 CTGCACTTTTGCAGGGAAGGAGG + Intergenic
1093113760 12:15184349-15184371 GAGCAGTCTTGCAGGGAAGAAGG + Intronic
1095052958 12:37570171-37570193 CTGCATTTTTAAAGGGAAGGAGG + Intergenic
1096333665 12:50736541-50736563 CAGCAGCTTTGCAGGACAGAAGG - Intronic
1096627461 12:52904412-52904434 CTCCAGTTTAAAAGGGAAGAAGG + Intronic
1096909282 12:54966023-54966045 CTGAAGTTTGGCAGGGTGGAAGG - Intronic
1098883509 12:75940682-75940704 ATGCTGTTTTGCTGGGAAGACGG + Intergenic
1099037087 12:77602082-77602104 CTGCAGTGTTGCAGAGAGGAAGG + Intergenic
1100146656 12:91686701-91686723 CTACAGAATTGCAGGGAAAATGG + Intergenic
1101232874 12:102759274-102759296 CTCCAGATTTGCTGGGTAGATGG - Intergenic
1102727925 12:115081804-115081826 ATGCAGTTGTCCTGGGAAGATGG + Intergenic
1103325608 12:120117729-120117751 CTGCAGTTCTGCAGTGAGGATGG - Intergenic
1104076106 12:125391553-125391575 CTGCAGGTCTGCAGGGGAGTAGG - Intronic
1104417736 12:128609268-128609290 CTACAGTGTTGCAGGGAGGTGGG - Intronic
1104605644 12:130185578-130185600 CAGCCATTTTGCAGGGAAGGAGG - Intergenic
1105899861 13:24745106-24745128 CTGGCGCTTTGCAGGGGAGAGGG - Intergenic
1108852599 13:54752098-54752120 CTGAACTTTTTCAGGGAAAAAGG - Intergenic
1108980660 13:56508820-56508842 CTGCAGGTAGGCAGGAAAGAAGG + Intergenic
1109073822 13:57806686-57806708 GTGCAGTTTTCCTGGGCAGAGGG - Intergenic
1109665363 13:65528076-65528098 CTGAAGTCTTGCAGGGAACCAGG - Intergenic
1110002610 13:70224126-70224148 CTGCAGGCTTGAAAGGAAGATGG + Intergenic
1111234514 13:85391156-85391178 CTCCTGTTATGCAGGGAAAATGG - Intergenic
1112164582 13:96904497-96904519 CAGTAGCTCTGCAGGGAAGAGGG + Intergenic
1113440206 13:110322718-110322740 CTGAAGTCTAGCAGGGAAGAAGG - Intronic
1118477988 14:66136244-66136266 CTGAAGTTTTGCAGAGAGTAAGG - Intergenic
1119725851 14:76921412-76921434 GTGTCTTTTTGCAGGGAAGAAGG - Intergenic
1119857659 14:77912881-77912903 CAACAGTTTAGCAGGCAAGAGGG + Intronic
1119917995 14:78420070-78420092 CTGCTTTTGGGCAGGGAAGATGG + Intronic
1121231890 14:92364506-92364528 CAGCAGCTATGCAGGGCAGAGGG + Intronic
1121610352 14:95274486-95274508 CTGCAGCTGTGCTGGGCAGAGGG - Intronic
1121787227 14:96671208-96671230 CTGCAGCTTTGGAGGGAAAGGGG - Intergenic
1121836817 14:97099678-97099700 TTGGAGTTTTGCAGGGAAAGGGG + Intergenic
1123005904 14:105323737-105323759 CTGCAGTGATCCAGGGAAGATGG + Intronic
1126796593 15:52264858-52264880 AGGCAGCTTTGCAGGGAAGGGGG - Intronic
1127044548 15:55011856-55011878 CTGGAGATTTCTAGGGAAGAGGG - Intergenic
1127610477 15:60631436-60631458 CTGGAGATTGGCAGGGAAGTAGG - Intronic
1129683316 15:77670774-77670796 CTGCTGCTGGGCAGGGAAGATGG + Intronic
1130166073 15:81460642-81460664 GTGAAGTTTTGCTGGGAACATGG + Intergenic
1130761279 15:86822674-86822696 ATGCAGTTTTTCAGGAAAGAAGG + Intronic
1131446462 15:92502041-92502063 CTGAGGTTCTGCAGGGAGGAGGG - Intergenic
1131583894 15:93672800-93672822 CTGCAGTGAGGCAGGAAAGATGG + Intergenic
1132838386 16:1966089-1966111 CCGCAGTATTGGAGAGAAGAGGG + Intergenic
1133972680 16:10578926-10578948 CTGCTGGTTTGCAGGGAATGAGG - Intronic
1135003326 16:18796323-18796345 CTGCAGTTTTACAGAGATGAGGG - Intronic
1136012685 16:27374312-27374334 CGGAAGTTCTGCAGGGAGGAAGG - Intergenic
1136279669 16:29200926-29200948 CTGCAGTTTTCCAGAGAAGAGGG - Intergenic
1138084512 16:54121556-54121578 CGGCAGATTCGCAGGGAAGCAGG + Exonic
1138124121 16:54424725-54424747 CTGCAGTGTTGCAGGGAGAGTGG + Intergenic
1139164350 16:64548268-64548290 CAACAGTTTTCCAAGGAAGATGG - Intergenic
1139344762 16:66295862-66295884 CTGCAGCCTTGCAGAGAAGAGGG + Intergenic
1139588449 16:67919422-67919444 CAGCAGGCTGGCAGGGAAGAAGG - Intronic
1140341397 16:74167697-74167719 CTCCAGTTTTGAAGGTGAGAGGG - Intergenic
1140777171 16:78260230-78260252 CAGCAGTGTTACTGGGAAGAGGG + Intronic
1141163385 16:81644284-81644306 CTACAATTTTCCAGGGAAGGAGG - Intronic
1141558855 16:84853673-84853695 CTGATGCTTTCCAGGGAAGATGG - Intronic
1142084059 16:88167023-88167045 CTGCAGTTTTCCAGAGAAGAGGG - Intergenic
1142804033 17:2362307-2362329 CTGCAGTTTTGGGGGGAACGGGG - Intronic
1142804059 17:2362395-2362417 CTGCAGTTTTGGGGGGAACGGGG - Intronic
1143383166 17:6508844-6508866 CTGGCGGTTTCCAGGGAAGATGG - Intronic
1143641330 17:8199785-8199807 CTGCTGTTTCTCAGAGAAGAGGG + Intergenic
1144524375 17:15977906-15977928 CTGCAGTCCTGGAGGGAAAAGGG + Exonic
1145373473 17:22326147-22326169 CTGCATTTTTAAAGGGAAGGAGG + Intergenic
1145781432 17:27566389-27566411 GTGCAGTGTCCCAGGGAAGAAGG - Intronic
1145916330 17:28576174-28576196 CTGCAGTGATGTAGGAAAGAGGG + Intronic
1146483396 17:33223751-33223773 TGGCAGTATTGCAGAGAAGACGG + Intronic
1150720823 17:67612780-67612802 CAGCAGTTGTGCAGGTGAGATGG + Intronic
1152626873 17:81391833-81391855 CTGCAGCTTTGCAGGTGAGCGGG - Intergenic
1153264155 18:3252299-3252321 CTTCAGAGTTGCAGGGAAGATGG - Intronic
1156005432 18:32435360-32435382 CTACAGTTTTTAGGGGAAGAAGG + Intronic
1156904259 18:42335557-42335579 CAGCACTTTCCCAGGGAAGATGG + Intergenic
1157199382 18:45646243-45646265 CTGGAGTTTTCCAGGCAGGAAGG + Intronic
1157564072 18:48668069-48668091 CTGCAGGTTTGGAGGGCTGAAGG - Intronic
1157648196 18:49299572-49299594 CCACAGTTTAGCAGGAAAGATGG - Intronic
1157998808 18:52592506-52592528 CTCCAGTTTTGCCGGGAGAAAGG - Intronic
1158331532 18:56368124-56368146 CTGCAGGTTGTCAGGGAAGTAGG + Intergenic
1159319600 18:66830183-66830205 TTGCAGTTTTGCAAGGTACAGGG + Intergenic
1160175936 18:76594041-76594063 GGGAAGTTTTGGAGGGAAGATGG - Intergenic
1160237247 18:77095673-77095695 CTGCTGTTCTCCAGGGAGGATGG + Intronic
1160363429 18:78303973-78303995 CTGAACCTTTGCAGGGTAGAAGG - Intergenic
1161845062 19:6707530-6707552 CTGAAGTTCTGCAGGGCAGGCGG + Exonic
1162486296 19:10962367-10962389 CTGCAGTCTTGGAGGGGAGCGGG + Intronic
1162755783 19:12858750-12858772 CTGCGGGGCTGCAGGGAAGATGG + Intronic
1163113980 19:15178348-15178370 CTGGAGGTTTGAAGGGAAAAGGG - Intronic
1164083672 19:21882280-21882302 CTGCAGTTTTGTCAGGAATAAGG - Intergenic
1164535660 19:29084896-29084918 GTGTAGTTTTGCAGGCAACAAGG + Intergenic
1165284178 19:34825502-34825524 CTGCAGCTTTTCTGGGAGGATGG - Intergenic
1165570072 19:36768653-36768675 CTGCATTTTTAAAGGGAAGGAGG - Intronic
1165743285 19:38216251-38216273 CTGCTGTCTTGCAGCCAAGAAGG - Exonic
1166504787 19:43364433-43364455 CTGTAGTTTTCCATGGAACAGGG + Intergenic
1166708788 19:44924133-44924155 CAGAAGTTTAGCAGGGAGGAGGG + Intergenic
925573758 2:5338529-5338551 CTTCAGTATTGCAGGAAAGATGG + Intergenic
926341369 2:11907369-11907391 CTGCACAGTTACAGGGAAGAAGG - Intergenic
927278890 2:21286475-21286497 CTGTAGTTGTCCAAGGAAGATGG + Intergenic
927291940 2:21413122-21413144 AGGCAGCTTTGCAGGAAAGAAGG - Intergenic
927358041 2:22196599-22196621 CTGCAGATTTGGAGGGATGGTGG - Intergenic
928098876 2:28423308-28423330 CTGCAGGTGTGCAGGAAAGGTGG + Intergenic
928772724 2:34720938-34720960 CTGGAATTTTGCAGTGAGGAAGG + Intergenic
929170397 2:38926685-38926707 CTGGGGTTCTGCAGGGAGGAAGG + Intronic
929827627 2:45321691-45321713 CTGCAGTTATTCAGGAGAGAAGG + Intergenic
930043450 2:47147391-47147413 TTGGAGCTTTGCAAGGAAGAAGG + Intronic
930983321 2:57554561-57554583 CTGGTCTTTTGCTGGGAAGATGG - Intergenic
931454591 2:62398630-62398652 CTGCAGAATGGCAGGGAAGGGGG - Intergenic
931525237 2:63145514-63145536 ATGCAGTTTCTCAGGGAAGTAGG + Intronic
932869591 2:75384802-75384824 CAGCAGTTTAGCATTGAAGAAGG - Intergenic
933659826 2:84918313-84918335 CTGCAGTTTCTCTGAGAAGAAGG - Intergenic
935657975 2:105441172-105441194 CTACAGGTGTCCAGGGAAGAGGG + Intergenic
936729590 2:115364238-115364260 CTTCACTTTGGCAGGGTAGATGG + Intronic
937596035 2:123674596-123674618 TTGCAGTTTTGGAGGGTGGAAGG - Intergenic
942066947 2:172280419-172280441 CTGCATTTTTGGAGGGGAGTGGG + Intergenic
942077198 2:172366931-172366953 CTGCAGCTATGCCAGGAAGAGGG + Intergenic
943621164 2:190149975-190149997 CTGCAGGTTGTCAGGGAAGTGGG + Intronic
944714018 2:202361114-202361136 CTGAAGCTTTGTAGGGGAGAGGG - Intergenic
947690986 2:232135523-232135545 TAGCTGTTTTTCAGGGAAGAAGG + Intronic
948000033 2:234560251-234560273 CTGCAGTTGTCCAGGGAAAGAGG + Intergenic
948099741 2:235364390-235364412 CTGCTCTTTTGCAGGGTAGGGGG + Intergenic
948440583 2:237984692-237984714 CTGCAGTTTAGCAGGGCATGGGG - Intronic
948967096 2:241391330-241391352 CTGCAAATGTGCTGGGAAGATGG + Intronic
1168827137 20:821630-821652 CTGCACTTTTGCCTGTAAGAAGG + Intergenic
1168919475 20:1519010-1519032 ATGCAGTTTGGCAAGGTAGATGG - Intergenic
1169182619 20:3583227-3583249 TTGCAATTTTGGAGGGAAGAAGG - Intronic
1169336216 20:4759580-4759602 CTGCAGGTTGTCAGGGAAGTGGG + Intergenic
1171165579 20:22967428-22967450 TTGCAGGTTGGCAGGGAAGTGGG - Intergenic
1171529318 20:25842221-25842243 CTGCATTTTTAAAGGGAAGGAGG - Intronic
1171547508 20:26013659-26013681 CTGCATTTTTAAAGGGAAGGAGG + Intergenic
1171727603 20:28639572-28639594 CTGAGGTTTTGTAGGGAGGAAGG - Intergenic
1171982799 20:31639114-31639136 CTGGAGTTAGGCAGGGAGGAAGG - Intronic
1172950279 20:38719188-38719210 CTTCAGTTATGCTGGGAAGCAGG - Intergenic
1173825174 20:46043619-46043641 CTTCTGTTTTGCAGGGATCATGG + Exonic
1174120447 20:48260853-48260875 CTCCAGCTTTGCAAGGTAGATGG - Intergenic
1174282942 20:49452525-49452547 CTTCAGTCTAGCAGGGAAAATGG + Intronic
1174503371 20:51001546-51001568 CTGGGGTTGTGCAGGGAAGCCGG - Intergenic
1174848239 20:53965091-53965113 CTGCAATTTGGCAGTGAAAATGG - Intronic
1177489156 21:21799779-21799801 CTGAAGTATTGCAGAGAAGAGGG + Intergenic
1178135313 21:29620349-29620371 CAGCAGTTTTACTGGGATGAGGG + Intronic
1178148778 21:29769832-29769854 CTGCAGTTTTGAAGGCTAGAAGG - Intronic
1178473055 21:32911872-32911894 CTGAGGTTTCCCAGGGAAGAAGG - Intergenic
1179186086 21:39086275-39086297 CTGCTGTTTAGCAGGGAGAAGGG + Intergenic
1179247470 21:39646153-39646175 CTGCAGCTTTGCCCGGAAGCTGG + Intronic
1179649035 21:42794704-42794726 CTGCAGGTTTGCAGCTCAGAGGG - Intergenic
1183048465 22:35241185-35241207 ATGCAGGTTGTCAGGGAAGAGGG + Intergenic
1183133401 22:35862417-35862439 CTGTAGTGTTTTAGGGAAGACGG - Intronic
1183574086 22:38675915-38675937 GGGCAGTTCTGCAGTGAAGAAGG + Intergenic
1184987896 22:48147858-48147880 CTGCACTTGGGCAGGGGAGAGGG - Intergenic
950327204 3:12121953-12121975 CTGAGGTTTTGCAGAGAAGAAGG - Intronic
950571561 3:13803349-13803371 CTGCATTATAGCAGGGAAGGGGG + Intergenic
953167802 3:40481164-40481186 CTCCAGCTTCTCAGGGAAGAAGG - Intronic
953538398 3:43793372-43793394 CTCAAGTTTTGCTGGGATGATGG + Intergenic
955356251 3:58235632-58235654 CTCCAGTTTTACAGTGAAGGAGG - Intergenic
956332051 3:68121872-68121894 CTGTAATTTTGCTGGGAGGAGGG + Intronic
957283623 3:78186553-78186575 CTGAAGTTTTGCAGAGAGGCAGG + Intergenic
958691814 3:97478912-97478934 CTGCTGTTTAGCAGTGAAAATGG + Intronic
958895194 3:99821533-99821555 CTGAAGGTTTACAGGGAATAAGG - Intronic
960147678 3:114220242-114220264 CTCCAGTTTGTCAGTGAAGAAGG + Intergenic
960965858 3:123104296-123104318 CTGGAGTTCTTCAGGGCAGAGGG + Intronic
961432235 3:126891382-126891404 CTGCAGGTTTACAGGGCAGGGGG + Intronic
962886456 3:139632423-139632445 CTCCAGTTCTGTAGGGCAGAGGG - Intronic
963419868 3:145048108-145048130 CTCCTGTTCTACAGGGAAGAAGG + Intergenic
963470827 3:145739832-145739854 CTGAAATTCTGAAGGGAAGAAGG + Intergenic
963849196 3:150192920-150192942 TTGTTGTTTTGAAGGGAAGAGGG + Intergenic
963930264 3:150996738-150996760 CTCCAGTTTTTCTGGGATGAGGG + Intergenic
964309945 3:155381875-155381897 GTTTAGTTTTGTAGGGAAGAGGG - Intronic
964310607 3:155387585-155387607 CTGCAGTTTGGCAAGGCAGTGGG - Intronic
964584014 3:158275455-158275477 CTGCAGCTTTACTGGGATGATGG - Intronic
964834230 3:160919964-160919986 ATACAGTGTTGCAGGGGAGAGGG - Intronic
965125682 3:164626585-164626607 ATGAAGGTTTTCAGGGAAGAAGG - Intergenic
966122396 3:176536965-176536987 ATGCAGGTTTTCAGGGAAGTTGG - Intergenic
966712511 3:182983977-182983999 GTGCAGTCTGGCAGGGGAGATGG - Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967836252 3:193965793-193965815 CTTCAGTTTTGGAGGGCTGAGGG + Intergenic
969269599 4:6090254-6090276 CTGCAGACATGCAGGGGAGAAGG + Intronic
969499995 4:7546824-7546846 ATGTGTTTTTGCAGGGAAGAGGG - Intronic
969652588 4:8476677-8476699 CTGCAGTATTTCTGGGGAGAGGG - Intronic
970300816 4:14679759-14679781 CTGCAGTTTCACAGAGAAAAGGG - Intergenic
971211804 4:24624868-24624890 CTGCTGTCTTCCAGGGAATATGG - Intergenic
971214427 4:24650295-24650317 CTGCAGTTTTCCAGGGAGTTCGG - Intergenic
971412961 4:26394808-26394830 CTGGAGTGTTGTAGGGGAGAAGG - Intronic
972256437 4:37360804-37360826 CTGCATATTTATAGGGAAGAGGG + Intronic
973723707 4:53751107-53751129 CTGCAGGCTGGGAGGGAAGAAGG - Intronic
974654336 4:64799884-64799906 CTGCAGTTTGGCAGGGGGAAGGG + Intergenic
974919997 4:68227103-68227125 ATGCAATCTTGCAGTGAAGAAGG - Exonic
974941720 4:68477516-68477538 CTGCATTTGTGTAGGGAACAGGG - Exonic
975427754 4:74250433-74250455 CTACATTTTCACAGGGAAGATGG - Intronic
976764240 4:88582478-88582500 CTGCACATTGGAAGGGAAGATGG - Intronic
977167561 4:93719905-93719927 CTGCAATTTTGAATGGAGGAGGG - Intronic
977615426 4:99083097-99083119 CTGCAGTTTTGCAGGGAAGATGG + Intronic
978367986 4:108002589-108002611 CTACCGTCTTGCAGGGAAGAGGG - Intronic
979239350 4:118434750-118434772 CAGCTGTTCTGCAGGGAAGGAGG + Intergenic
979350836 4:119642858-119642880 CTGCACTTTCATAGGGAAGAAGG - Intergenic
979984322 4:127295618-127295640 CTGTGGTTTTGCAGGGTACAGGG + Intergenic
980039153 4:127918969-127918991 CTGCAGAATAGCAGGTAAGAGGG + Exonic
981037897 4:140191299-140191321 CTACAGTTTTGAAGGCATGAGGG + Intergenic
981409377 4:144410835-144410857 CTGAAGTTTTGGAGGGAAGAGGG - Intergenic
981838007 4:149077914-149077936 CTGCTGTTTTTAAGGGAAAATGG - Intergenic
982727116 4:158917608-158917630 TTGCAGTTTTCCAGGAAATAAGG - Intronic
982819225 4:159925895-159925917 CTGAAGTGTTGCAGGAATGAAGG + Intergenic
982953235 4:161727617-161727639 CTGCATTTTTGCATGGAATTTGG + Intronic
985526674 5:406684-406706 GTGCAGTTTCACAGGGGAGAAGG - Intronic
985657961 5:1141991-1142013 CTGCAGGGCTGCAGGGAAGAGGG - Intergenic
985864481 5:2503526-2503548 TTGCAGCTGTGAAGGGAAGAGGG + Intergenic
985965307 5:3335234-3335256 ATGCAGGTTTGCTGGGAGGACGG - Intergenic
986066491 5:4239740-4239762 CTGCTGTGTTGCAGGGATGAGGG - Intergenic
986751763 5:10793995-10794017 CTGCATGTTTGCAGAGCAGATGG - Intergenic
987016413 5:13824575-13824597 CTACAGCTTGGCAGGGAAAAAGG + Intronic
987024627 5:13912031-13912053 CTGCAGCTTTGCAGGGCAGTAGG - Intronic
987885134 5:23802870-23802892 CTTCAGTTCTGCAGGCTAGAAGG - Intergenic
988354352 5:30153314-30153336 ATGCAGATTGGCAGAGAAGAAGG + Intergenic
988499450 5:31772276-31772298 GAGCAGTTTGGCAGGAAAGACGG - Intronic
988676811 5:33441104-33441126 CAGCAGTCCTTCAGGGAAGATGG + Exonic
992774425 5:80077175-80077197 CTGCAGCTATGCAGAGAAGCTGG - Intronic
994011110 5:94904021-94904043 CTGCATTTTGGCAGGCAAGACGG - Intronic
994290171 5:98020313-98020335 CTGCCCTTTTGCAGGCAACATGG - Intergenic
994568390 5:101483021-101483043 ATGCAGGTTTTCAGGGAAGTGGG + Intergenic
994686518 5:102960426-102960448 CTACAGTTTGCCAGGGAAAATGG + Intronic
994875290 5:105413881-105413903 ATGCAGGTTTTCAGGGAAGTAGG - Intergenic
996010737 5:118479076-118479098 ATGCAGGTTTTCAGGGAAGCAGG - Intergenic
996025275 5:118638634-118638656 CTACAGGTTTCCAGGGAAGTAGG - Intergenic
996288957 5:121829110-121829132 ATGCAGATTTTCAGGGAAGTGGG + Intergenic
996540574 5:124626886-124626908 TGGAACTTTTGCAGGGAAGAAGG - Intergenic
998901922 5:146864728-146864750 CTGGAGCTTTGCGGGGTAGAAGG + Intronic
1001174854 5:169458740-169458762 CTGTAGTTTTTCAGGGGACAGGG + Intergenic
1001804443 5:174571211-174571233 CTGCAACTATCCAGGGAAGAAGG - Intergenic
1001863742 5:175084160-175084182 CTGCATTTTGGCTGTGAAGATGG + Intergenic
1002739593 5:181425330-181425352 CGGCTGTTCTGCAGGGAAGGAGG + Intergenic
1002837450 6:876895-876917 CTGAAGTTCTGCAGAGCAGACGG + Intergenic
1003005784 6:2380332-2380354 CTGCAGTTTAATAGGGAAGATGG - Intergenic
1005581289 6:27237826-27237848 CTGCACTCCCGCAGGGAAGAAGG + Intergenic
1005959148 6:30683984-30684006 TTGCAGTTTTTCTGGGGAGAAGG - Intronic
1008169393 6:48184048-48184070 TTGCAGTATGGCAGGGAAGAAGG + Intergenic
1009417116 6:63428205-63428227 CAGCATTTTAGTAGGGAAGAAGG - Intergenic
1009554720 6:65148555-65148577 CTGCAGTTTTTCTGGGTACATGG + Intronic
1010898480 6:81396126-81396148 CTGTTGTTTTGGAGGGAATAAGG - Intergenic
1011382956 6:86762294-86762316 CTCCACTTTTGCAGAGCAGAAGG - Intergenic
1011421812 6:87181140-87181162 CTGCTTTATTGCAAGGAAGAGGG + Intronic
1014342885 6:120230245-120230267 GTGAAGTTTTGCTGGGAATAGGG - Intergenic
1014348074 6:120300910-120300932 ATGCAGTTTGGAAGAGAAGAGGG - Intergenic
1015573494 6:134646369-134646391 CTGCAGTGTAGCAGAGAAGAAGG - Intergenic
1018596614 6:165487860-165487882 CTGCAAGTGTGCAGGGAAAAGGG - Intronic
1018605308 6:165591477-165591499 CTTGGGTTTTGAAGGGAAGATGG - Intronic
1019244709 6:170700917-170700939 CGGCTGTTCTGCAGGGAAGGAGG + Intergenic
1019591622 7:1838599-1838621 CTGCAGTGTTGCAGGGAGATGGG - Exonic
1019625320 7:2012946-2012968 CAGCAGCTGTTCAGGGAAGATGG - Intronic
1019671009 7:2278298-2278320 CGGCAGATCTGCAGGGGAGATGG + Exonic
1020839658 7:13199638-13199660 CTGCACCTTTTCAGGGAGGAAGG - Intergenic
1021136588 7:16971951-16971973 CTGCAGTTAAGCAGGGAACCAGG - Intergenic
1021629583 7:22631313-22631335 CTGAAGTTTCCCAGAGAAGAAGG - Intronic
1022746685 7:33180116-33180138 GAGCAGTTTGGCAGGAAAGACGG - Intronic
1023117938 7:36880850-36880872 CTCCAACTTTGCAAGGAAGATGG - Intronic
1024110677 7:46143345-46143367 TTGCAGTATTGCAGGGACCAAGG + Intergenic
1024426246 7:49229580-49229602 CTGAAGGTTTTCAGGGAAAATGG + Intergenic
1024511934 7:50211636-50211658 CTGCAGTGCAGCAGGAAAGAGGG + Intergenic
1026583390 7:71636320-71636342 CTGCAGTTCTCTGGGGAAGATGG + Intronic
1026731436 7:72914998-72915020 CTCCACCTCTGCAGGGAAGAGGG + Intronic
1028182981 7:87747741-87747763 CTGCAGATTGTCAGGGAAGTGGG + Intronic
1029327539 7:99823103-99823125 CTGCAGCTGTGCAGGGTAGGGGG - Intergenic
1030707953 7:112714719-112714741 CAGCAATTGTGCAGGGTAGAGGG + Intergenic
1033425070 7:141236534-141236556 CTGCAATATTTGAGGGAAGATGG - Intronic
1034214165 7:149391628-149391650 CTGCAGTTTTTCATGGTGGATGG + Intergenic
1034457497 7:151178980-151179002 GGGCAGTTTTGAAGGGAAGGAGG - Intronic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034828629 7:154289703-154289725 CTGAAGTTGTGCAGAGAAGGTGG - Intronic
1035225034 7:157428156-157428178 CTGCAGTTGAGGAGGGAGGAGGG + Intergenic
1035503417 8:107271-107293 CGGCTGTTCTGCAGGGAAGGAGG - Intergenic
1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG + Intronic
1039924346 8:41915736-41915758 TTGCAGGTTTGGGGGGAAGATGG - Intergenic
1040563287 8:48543729-48543751 CTGCAGTTTTCTAGGTTAGAAGG - Intergenic
1040639265 8:49313386-49313408 CTTCATTTTTGCAGAGGAGAAGG - Intergenic
1041215977 8:55600514-55600536 CAGCAGCTTTGCAGGGAGGTGGG - Intergenic
1041506305 8:58601857-58601879 CTGCAGTTTAGGAAGGAGGAGGG - Intronic
1041800472 8:61792460-61792482 CTGGAGTGTTTCAGGGAAAAAGG + Intergenic
1041895200 8:62916693-62916715 TTGCAGATTTGCAGAGAGGAAGG + Intronic
1043528279 8:81120511-81120533 CTGCAGTCCAGCAGGAAAGAAGG - Intergenic
1044824353 8:96182400-96182422 ATGCTGTTGTGCATGGAAGAGGG + Intergenic
1044878922 8:96702058-96702080 CTGAAGTTGTGCTGGCAAGATGG + Intronic
1046355757 8:113082299-113082321 ATGCAGCTTTGCTGGGAACAGGG - Intronic
1046695997 8:117340313-117340335 CTGCAGTATGCCAGGGAAGAAGG + Intergenic
1046728816 8:117703449-117703471 CTGCAGTTCTGGAAGGAAGGTGG + Intergenic
1047201088 8:122768337-122768359 CAGTAGTTTTGAAGGGAACAGGG + Intergenic
1047390778 8:124449263-124449285 CTGCTTTTCTGCAGGGCAGAAGG - Intergenic
1047405991 8:124586321-124586343 GTGCAGATAGGCAGGGAAGATGG - Intronic
1047730896 8:127727273-127727295 TTCCAGTTTTTCAGGGAAGGTGG - Intergenic
1049077644 8:140412214-140412236 TTGCATTTTGGCAGGGCAGAAGG - Intronic
1049508534 8:143016317-143016339 CTGCAGTATTGCTGGGAAAGAGG + Intergenic
1049655218 8:143794197-143794219 CTGGAGCTTTGCAGGAGAGATGG + Intronic
1050396643 9:5204886-5204908 CGGAAGATATGCAGGGAAGACGG + Intergenic
1053722141 9:40957526-40957548 CTGAGGTTTTGTAGGGAGGAAGG + Intergenic
1053797296 9:41738510-41738532 CTGCATTTTTAAAGGGAAGGAGG - Intergenic
1054147897 9:61576421-61576443 CTGCATTTTTAAAGGGAAGGAGG + Intergenic
1054185710 9:61950577-61950599 CTGCATTTTTAAAGGGAAGGAGG - Intergenic
1054343832 9:63894468-63894490 CTGAGGTTTTGTAGGGAGGAAGG - Intergenic
1054467640 9:65507511-65507533 CTGCATTTTTAAAGGGAAGGAGG + Intergenic
1054652802 9:67637928-67637950 CTGCATTTTTAAAGGGAAGGAGG + Intergenic
1054764909 9:69035488-69035510 CTGCTGTCTTGCTGGGAAGTGGG - Exonic
1055737738 9:79350323-79350345 TTGCAGTTTTGCAAGGAATTGGG - Intergenic
1056063910 9:82913773-82913795 TTGGAGTTTAGCAGGGAATACGG + Intergenic
1056067304 9:82949967-82949989 CTGCATTTCTGCATGGAACATGG - Intergenic
1056721979 9:89080429-89080451 GTCCAGTTCTGAAGGGAAGATGG - Intronic
1057674004 9:97122225-97122247 CTGCAGTGTTGCAGACAGGATGG - Intergenic
1057765148 9:97910120-97910142 CAGCAGTCTTGCAAGGAAGCAGG - Exonic
1058164013 9:101600420-101600442 TTACAGTTTTGATGGGAAGATGG + Intronic
1058758150 9:108102926-108102948 CTGCTGCTTTGCAGAGAGGAAGG + Intergenic
1060447166 9:123700586-123700608 CTGAGGTTTTCCAGAGAAGAAGG - Intronic
1061659354 9:132118380-132118402 CTGTTGTTATGAAGGGAAGATGG - Intergenic
1061919510 9:133775035-133775057 CTGTAGGTTTGCAGGTAACATGG - Exonic
1061994067 9:134175243-134175265 TTGGAGTTTGCCAGGGAAGAGGG + Intergenic
1203604899 Un_KI270748v1:50137-50159 CGGCTGTTCTGCAGGGAAGGAGG + Intergenic
1185956531 X:4497125-4497147 ATGAAGTTCTTCAGGGAAGAAGG - Intergenic
1186511010 X:10129784-10129806 CTTCTGTTTTCCAGGGAAGATGG - Intronic
1186574777 X:10753035-10753057 CTGCAGTTTTAAGGGGAAGTTGG + Intronic
1187235824 X:17466182-17466204 CTGCAGTGGGGCAGGCAAGAGGG + Intronic
1188734802 X:33699928-33699950 TTGAAGTGTGGCAGGGAAGAAGG - Intergenic
1190032109 X:46983818-46983840 CACCAATTTTGCTGGGAAGAGGG + Intronic
1191080346 X:56504216-56504238 ATGCAGGTTTTCAGGGAAGTGGG - Intergenic
1191925503 X:66305226-66305248 CTGCAGTATTGTAGGGATAATGG + Intergenic
1192055554 X:67769624-67769646 GTGTAGGTTTCCAGGGAAGAAGG - Intergenic
1192384454 X:70652063-70652085 TTGCAGTTTTCCAGGGATGTGGG - Intronic
1192881127 X:75285057-75285079 CTGCAGGTTGTCAGGGAAGTGGG + Intronic
1193593958 X:83423054-83423076 CTGAAGTTGTGCAGGGCAGTGGG - Intergenic
1193817819 X:86125430-86125452 TTGGAGATTTCCAGGGAAGAGGG + Intergenic
1194165348 X:90508054-90508076 ATGCAGGTTTTCAGGGAAGCTGG - Intergenic
1194299102 X:92163092-92163114 ATGCAGTTTGTCAGGGAAGTAGG + Intronic
1194647305 X:96473138-96473160 CTGAAGCTTTGCAGTGCAGATGG - Intergenic
1195139998 X:101949864-101949886 CTGGAGTTTGGCTGGCAAGATGG + Intergenic
1196852432 X:119950109-119950131 CAGAAGTTTGGCAGGGAAGAAGG - Intergenic
1197719534 X:129735748-129735770 CTGCAGTTCTGCAGGTGGGAAGG - Intergenic
1198995562 X:142569788-142569810 CTCCAGCTTTTCAGGGAAAAGGG - Intergenic
1199690001 X:150302344-150302366 CTGCTCTTTTGCTGGCAAGATGG + Intergenic
1199810847 X:151347034-151347056 CTCCAGCTTTGTAGGGAAGGGGG + Intergenic
1200104269 X:153703613-153703635 CGGCAATCTTGCAGGGAACAAGG + Intronic
1200511617 Y:4085864-4085886 ATGCAGGTTTTCAGGGAAGTTGG - Intergenic
1200616705 Y:5387926-5387948 ATGCAGTTTGTCAGGGAAGTAGG + Intronic
1201315788 Y:12644101-12644123 ATGCAGGTTGTCAGGGAAGAGGG - Intergenic
1201921508 Y:19238856-19238878 CAGCACTTTTGCAGTCAAGATGG - Intergenic