ID: 977621375 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:99141514-99141536 |
| Sequence | TTTATTTTATTCAGAAAAAA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2034 | |||
| Summary | {0: 1, 1: 1, 2: 21, 3: 179, 4: 1832} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 977621375_977621379 | 6 | Left | 977621375 | 4:99141514-99141536 | CCATTTTTTCTGAATAAAATAAA | 0: 1 1: 1 2: 21 3: 179 4: 1832 |
||
| Right | 977621379 | 4:99141543-99141565 | GGTTTGACGTTGGTCACTCCTGG | 0: 1 1: 0 2: 1 3: 1 4: 52 |
||||
| 977621375_977621377 | -4 | Left | 977621375 | 4:99141514-99141536 | CCATTTTTTCTGAATAAAATAAA | 0: 1 1: 1 2: 21 3: 179 4: 1832 |
||
| Right | 977621377 | 4:99141533-99141555 | TAAAATACCTGGTTTGACGTTGG | 0: 1 1: 0 2: 1 3: 8 4: 77 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 977621375 | Original CRISPR | TTTATTTTATTCAGAAAAAA TGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||