ID: 977621375

View in Genome Browser
Species Human (GRCh38)
Location 4:99141514-99141536
Sequence TTTATTTTATTCAGAAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2034
Summary {0: 1, 1: 1, 2: 21, 3: 179, 4: 1832}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977621375_977621379 6 Left 977621375 4:99141514-99141536 CCATTTTTTCTGAATAAAATAAA 0: 1
1: 1
2: 21
3: 179
4: 1832
Right 977621379 4:99141543-99141565 GGTTTGACGTTGGTCACTCCTGG 0: 1
1: 0
2: 1
3: 1
4: 52
977621375_977621377 -4 Left 977621375 4:99141514-99141536 CCATTTTTTCTGAATAAAATAAA 0: 1
1: 1
2: 21
3: 179
4: 1832
Right 977621377 4:99141533-99141555 TAAAATACCTGGTTTGACGTTGG 0: 1
1: 0
2: 1
3: 8
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977621375 Original CRISPR TTTATTTTATTCAGAAAAAA TGG (reversed) Intronic
Too many off-targets to display for this crispr