ID: 977621429

View in Genome Browser
Species Human (GRCh38)
Location 4:99142135-99142157
Sequence CCAGGCTTATATTTTCCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977621429_977621435 -4 Left 977621429 4:99142135-99142157 CCTCAAGGAAAATATAAGCCTGG 0: 1
1: 0
2: 1
3: 29
4: 211
Right 977621435 4:99142154-99142176 CTGGTCAGCTTGGGAAAAATGGG No data
977621429_977621436 -3 Left 977621429 4:99142135-99142157 CCTCAAGGAAAATATAAGCCTGG 0: 1
1: 0
2: 1
3: 29
4: 211
Right 977621436 4:99142155-99142177 TGGTCAGCTTGGGAAAAATGGGG 0: 1
1: 0
2: 2
3: 18
4: 203
977621429_977621434 -5 Left 977621429 4:99142135-99142157 CCTCAAGGAAAATATAAGCCTGG 0: 1
1: 0
2: 1
3: 29
4: 211
Right 977621434 4:99142153-99142175 CCTGGTCAGCTTGGGAAAAATGG 0: 1
1: 1
2: 2
3: 33
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977621429 Original CRISPR CCAGGCTTATATTTTCCTTG AGG (reversed) Intronic
900625711 1:3607695-3607717 CCAGGCCTTTCTGTTCCTTGCGG + Intronic
900741740 1:4334314-4334336 CCAGGCTTTCCTCTTCCTTGTGG + Intergenic
906820701 1:48927129-48927151 CCAGGCTTCCCTGTTCCTTGTGG - Intronic
907958009 1:59249997-59250019 CCAGGCTGATTGTGTCCTTGGGG - Intergenic
912177135 1:107173414-107173436 CCTGGCTTATTGTTTGCTTGAGG + Intronic
912599231 1:110911179-110911201 CCAGGTTTTTTTTTTCCCTGGGG - Intergenic
913548047 1:119889124-119889146 TCAGGATTATTTTTTCCTTCAGG - Intergenic
914720848 1:150287618-150287640 CCAGGTTTATGTTTTCATTCAGG + Intergenic
917804961 1:178605230-178605252 CCAGGCTTTTATATGTCTTGAGG + Intergenic
918562003 1:185880133-185880155 TGAGGGATATATTTTCCTTGGGG + Intronic
920131236 1:203733476-203733498 CCATGGTTATCTTTTCCTTTTGG + Intronic
920227108 1:204446956-204446978 CCAGGCTGATCTCATCCTTGGGG - Intronic
920617589 1:207508867-207508889 GCAGGATTATATTTTCCATATGG - Intronic
920633976 1:207680878-207680900 GCAGGATTATATTTTCCATATGG - Intronic
923218168 1:231869339-231869361 CCTGACTTATATTTTTGTTGAGG - Intronic
923839440 1:237652052-237652074 CTTGGCTTATCTTTTCCCTGTGG - Intronic
1063746124 10:8883920-8883942 CCAGGCTCTTAATTTCCATGAGG + Intergenic
1063819028 10:9813025-9813047 CCAGGTTTCTTTTTACCTTGTGG - Intergenic
1066017022 10:31257581-31257603 CCAGGCATATTTTTTCCTGCTGG + Intergenic
1066341045 10:34534103-34534125 CCCGGCTAATTTTTTCCTTCTGG - Intronic
1067038690 10:42936898-42936920 CCAGGTTTGTATAGTCCTTGAGG - Intergenic
1067043784 10:42973031-42973053 GTAGCCTTATTTTTTCCTTGTGG + Intergenic
1067552489 10:47245520-47245542 TCAGGCTTACATTGTCCTGGGGG - Intergenic
1071342407 10:84661055-84661077 TCAGGCCAATATTTTCCTTCAGG + Intergenic
1071594947 10:86914581-86914603 CCATTCTTATATCTTCTTTGGGG - Intronic
1074388781 10:113038914-113038936 CCAGCCATTTATTTTGCTTGAGG + Intronic
1074661194 10:115659479-115659501 ACATGGATATATTTTCCTTGTGG - Intronic
1075792241 10:125093281-125093303 CCTGCCTTCTGTTTTCCTTGTGG - Intronic
1079307038 11:19332501-19332523 CCAGGCTTATATTTTTCAGAAGG + Intergenic
1079891899 11:26066573-26066595 ACAGGCTTAACTTTTCCTTTGGG - Intergenic
1080439899 11:32283153-32283175 CCAGCCATATATTTTCTTTAGGG - Intergenic
1086198011 11:84165473-84165495 GCAGGCTTATATTTACCTCATGG + Intronic
1088279680 11:108123272-108123294 ACAGGCTTATTTTTTTCATGAGG - Intronic
1089633990 11:119800773-119800795 CCAGTCTCACATTTCCCTTGGGG - Intergenic
1091617735 12:2062536-2062558 CCTGGCTTAGATTTGCCTTGTGG + Intronic
1092333977 12:7612157-7612179 CCAACCTTATATGTTCATTGAGG - Intergenic
1092938129 12:13382993-13383015 CCAAGCTTAACTTTTCCTTTAGG + Intronic
1095638678 12:44461380-44461402 CCAGGCCTACATTTTTCCTGGGG - Intergenic
1095847918 12:46766784-46766806 ACAGGCTTTAATTTTCCTTGTGG - Exonic
1099905834 12:88768769-88768791 GTATGCTTATATTTTCCTAGGGG - Intergenic
1100980787 12:100160789-100160811 CCATCCATATGTTTTCCTTGTGG - Intergenic
1101038869 12:100733697-100733719 CCAGTCATATATTTACATTGTGG + Intronic
1101082424 12:101202088-101202110 CAAGCCTTATTTTCTCCTTGGGG - Intronic
1103959450 12:124599853-124599875 CTGTGCTTTTATTTTCCTTGAGG + Intergenic
1106027659 13:25970626-25970648 GAAGGCTAATATTTTCTTTGGGG + Intronic
1106595782 13:31134683-31134705 CCAGACTTCTATTTTGCCTGTGG - Intergenic
1106816094 13:33408809-33408831 CCAGGCTTACTCTTACCTTGAGG + Intergenic
1108692565 13:52872459-52872481 CCTAGCTTATTTTTTCCTTTTGG - Intergenic
1111657497 13:91172050-91172072 CCAGTGATATATTTTCCTTGAGG + Intergenic
1114997377 14:28373258-28373280 CCAGGCTTAAATTTTTATTAGGG - Intergenic
1115149951 14:30272997-30273019 ACATGCTTCTCTTTTCCTTGGGG + Intergenic
1115351284 14:32398338-32398360 CCAGGTGTTTATTTACCTTGAGG + Intronic
1116624466 14:47247133-47247155 CAAGGTTTAAATTTTCCTTGTGG - Intronic
1118169197 14:63369409-63369431 CCAGGCTTTTTTTTTCCCTTTGG + Intergenic
1118589706 14:67392379-67392401 TCAGGCTAATTTCTTCCTTGGGG + Exonic
1119277125 14:73368095-73368117 CCAGCCACATATTTTCTTTGGGG - Intronic
1120626142 14:86829306-86829328 CCAGGGTTATAGTTTTCTCGAGG + Intergenic
1122056774 14:99104099-99104121 CAAGCTTTATATTTTCCATGTGG + Intergenic
1124289114 15:28431455-28431477 CCAGGCATATATTGTCTATGAGG + Intergenic
1124294108 15:28485855-28485877 CCAGGCATATATTGTCTATGAGG - Intergenic
1124874647 15:33580605-33580627 CCAAGCTGATATTTTCCTCATGG - Intronic
1124956072 15:34361332-34361354 CCAGGCTGACATGTTCCTAGTGG - Intronic
1128246846 15:66138826-66138848 CCATGCTGATATTTTCCCTGGGG - Intronic
1128377054 15:67084444-67084466 CAATGCATATATTTTCCTGGGGG + Intronic
1128389094 15:67170817-67170839 CCAGGTTTGTATTTCCCCTGGGG + Intronic
1128495735 15:68197428-68197450 CCAGGCTGTTACCTTCCTTGTGG + Exonic
1128837959 15:70826443-70826465 CCAGGATTATTTTTTCATTAAGG + Intergenic
1129561131 15:76570691-76570713 TCAGGCTTATCTTTTCCCTATGG + Intronic
1130440336 15:83946517-83946539 TCTGGTTTATATTGTCCTTGAGG + Intronic
1132006128 15:98228885-98228907 CCAAGCTTATATGATGCTTGAGG - Intergenic
1134423111 16:14112718-14112740 CCAGGGATATTTTTGCCTTGGGG + Intronic
1134605943 16:15571311-15571333 CCAAGCTTAACTTTTCCTTTTGG - Intronic
1135494173 16:22937186-22937208 CTAGGCTTAGAATTTCCTAGTGG - Intergenic
1149782002 17:59405187-59405209 CCAGCCTTATATTTCTTTTGAGG + Intergenic
1150709817 17:67521469-67521491 GCAGGTTTGTATTTTCTTTGTGG + Intronic
1152969708 18:149771-149793 CCAGGCTTGTATTGTGCTTCTGG + Intergenic
1156287330 18:35710435-35710457 GGATGCTTTTATTTTCCTTGGGG + Exonic
1157136527 18:45062322-45062344 CCTGGCTGATACTTCCCTTGAGG + Intronic
1158426451 18:57344371-57344393 TCAGGCTGACATTTTCCTTAGGG + Intergenic
1158568067 18:58572103-58572125 CCAGTTGTATATTTTCTTTGGGG - Intronic
1159493190 18:69165132-69165154 CCGGGCTCATGTTTTCCTTGGGG + Intergenic
1163125166 19:15240554-15240576 CCAGGCTTCTCTCTTCCGTGGGG - Intronic
1163311340 19:16516744-16516766 CCAGGCCTCTCGTTTCCTTGTGG + Intronic
1163560922 19:18018983-18019005 CCAAGCTGATTTTTACCTTGGGG + Intergenic
1164138853 19:22439539-22439561 CCAGGTTTATATTTTTCTTCTGG + Intronic
1164182151 19:22828811-22828833 CCAGGTTTATATTTTTCTTCTGG + Intergenic
1165828923 19:38720867-38720889 CCAGGCTGGCATTTTCCCTGCGG + Intronic
1166625725 19:44353598-44353620 CCATCCTTATATCTTCTTTGCGG - Intronic
925237817 2:2294310-2294332 CCAGGCTTTTGTTGTGCTTGGGG - Intronic
925473187 2:4184778-4184800 CCAGACTTGTATTTTCTCTGGGG + Intergenic
925641002 2:5985795-5985817 CGGGGCTATTATTTTCCTTGTGG - Intergenic
927666209 2:25034707-25034729 CCAGGTTTACAATTTCCTGGAGG + Intergenic
927889798 2:26741269-26741291 CTATGCTTTTATTTCCCTTGTGG + Intergenic
931736629 2:65199979-65200001 CCAGGCTTGTCCTTTCCTTCAGG - Intergenic
933610655 2:84431055-84431077 CCAGTTTTAGACTTTCCTTGTGG - Intronic
937169884 2:119855405-119855427 ACAGGGCTATATTTTCTTTGCGG - Intronic
938147273 2:128846882-128846904 CCAGCCATATATCTTCTTTGGGG + Intergenic
938179651 2:129168867-129168889 CCAGGCTCATTGTCTCCTTGAGG + Intergenic
939486624 2:142820802-142820824 CTAAGCATATACTTTCCTTGGGG - Intergenic
941009838 2:160286831-160286853 CCAGGATTAAATCTTCCTTTCGG - Intronic
941647986 2:168062217-168062239 CCAGGCTCATGTTGTCATTGAGG - Intronic
942093716 2:172518336-172518358 CCATCCATATATTTTCCTTATGG + Intergenic
945081149 2:206086998-206087020 ACAGCCTTAGATTTTTCTTGAGG + Intergenic
946708263 2:222480572-222480594 ACAGGCTTATGATTTCCTAGTGG - Intronic
946766434 2:223045040-223045062 CCAGGATTTTTTTTTCCTTTGGG - Intergenic
1169106797 20:3003175-3003197 ACAAGTTTATATTGTCCTTGAGG + Intronic
1170135335 20:13067748-13067770 ATATGCTTATATTTTCCTTTTGG - Intronic
1170722917 20:18900146-18900168 CCTAGTTTATATTTTCCTAGAGG - Intergenic
1171876583 20:30583302-30583324 CCATCCTTATATCTTCTTTGCGG + Intergenic
1175380771 20:58561654-58561676 CCTGGCTTACATTTTCCCTCTGG - Intergenic
1182941473 22:34281475-34281497 TCAGGGTTTTACTTTCCTTGTGG + Intergenic
1184206469 22:43007140-43007162 CCTGCCTTATATTCTCCTGGAGG - Intronic
949618776 3:5786569-5786591 CCAGGTCTATAGTTTCCCTGAGG + Intergenic
950921425 3:16698475-16698497 CCAGGCTTATATGTTGCTGTGGG - Intergenic
951746235 3:25980783-25980805 CCAGGCAATTATTTTTCTTGGGG + Intergenic
952127303 3:30315880-30315902 CCACTCTTATATTTTCATTGTGG - Intergenic
955599366 3:60628833-60628855 CCAGGCTCAGATTTTGCTAGGGG - Intronic
957741767 3:84279848-84279870 CCACGATTATAAATTCCTTGAGG - Intergenic
958943415 3:100338168-100338190 CCAAGCTTATTTCTTCCTGGAGG - Intronic
960660567 3:120053566-120053588 CCAGTTTTATCTTTTCCTTGTGG - Intronic
961633937 3:128321314-128321336 CCAGGCTTACATTTTCTGAGAGG + Intronic
962181855 3:133214446-133214468 CTAGTCTTTTATTTTCCCTGAGG + Intronic
962651119 3:137492537-137492559 TCAGTCATATATTTTCTTTGAGG - Intergenic
962784220 3:138751566-138751588 CAAAGCTTAAATTTTCCTTAAGG + Intronic
965419188 3:168436152-168436174 CCAGGATTATATGTTCCATGTGG - Intergenic
965419339 3:168437471-168437493 CCAGGATTATATGTTCTATGTGG + Intergenic
965526648 3:169727018-169727040 CCATTCTAATAGTTTCCTTGTGG + Intergenic
966024839 3:175265102-175265124 CTTGGATTATATTTTCCTAGTGG + Intronic
966119598 3:176507339-176507361 ACAGGGTTATATTTTCTTTGTGG - Intergenic
966820805 3:183922804-183922826 ACACGCTTATGTTCTCCTTGTGG - Intronic
968848925 4:3064606-3064628 TTAGGCTTCTATTTTACTTGTGG - Intergenic
969594785 4:8142848-8142870 CCAGGCTGATGTTCTCATTGAGG - Intronic
971715737 4:30174215-30174237 CCACACTTATATTTTCTTGGTGG + Intergenic
971842140 4:31866805-31866827 CCAGGTTGGTAGTTTCCTTGTGG + Intergenic
972333963 4:38089222-38089244 CCAGGCTAATATCTGCCTTCTGG + Intronic
972414072 4:38821505-38821527 CCAGGCATGTATTTTTTTTGAGG + Intronic
973162475 4:47035192-47035214 CAGGGATTATATTTTACTTGGGG - Intronic
973198183 4:47469530-47469552 CCAGTTTTATATTTTGCTAGTGG - Intergenic
975032693 4:69641505-69641527 CCAGGCTTTTTTTGGCCTTGGGG - Intronic
976901735 4:90185668-90185690 CAAGACTAATATTTTGCTTGAGG - Intronic
977073857 4:92428482-92428504 ACAGGTTTATTTTTTCCTTGTGG + Intronic
977621429 4:99142135-99142157 CCAGGCTTATATTTTCCTTGAGG - Intronic
977872215 4:102105732-102105754 TCAGGGTTATGTTTTCCTTTAGG - Intergenic
978850845 4:113334212-113334234 CCAGGCTTATCTTATCCAAGGGG + Intronic
979148934 4:117283199-117283221 CTAAGCTTATATTCTTCTTGTGG + Intergenic
979627529 4:122862097-122862119 CCAATGTTATATTTTCCTTTGGG + Intronic
980642952 4:135603317-135603339 ACAGGTTTATATTTCCTTTGTGG + Intergenic
982220639 4:153122236-153122258 CCAGGCTTATTTTTTCTTAGAGG - Intergenic
982466634 4:155740716-155740738 CCAGCCTGATATTTTCATTTTGG + Intergenic
983454850 4:167951231-167951253 ACATGTTTATATTTACCTTGAGG - Intergenic
983474752 4:168199663-168199685 CCAGACATATATTTTTCTAGGGG - Intergenic
984988904 4:185358997-185359019 CAATGAATATATTTTCCTTGTGG + Intronic
986493821 5:8321164-8321186 ACATGCTTATATTTGCCTTGAGG - Intergenic
988266856 5:28962791-28962813 CCTGGCTTTTCATTTCCTTGAGG + Intergenic
988336949 5:29920000-29920022 TCAGGATTATATTTTCTTTGTGG - Intergenic
988812891 5:34802654-34802676 CCAAGCTTATATTCTCATGGGGG + Intronic
990277028 5:54208061-54208083 CCAGGCTTACATTCTCCAGGTGG + Intronic
990561835 5:56991246-56991268 GATGGCTTCTATTTTCCTTGAGG - Intergenic
990718234 5:58662981-58663003 CCGTGCTTATATTCTCCTTGAGG - Intronic
992114939 5:73530950-73530972 CCAAGCTTAAATTTTCCCTTTGG - Intergenic
992852885 5:80828752-80828774 CAAGGCTTAGTTTTTCCTTTGGG - Intronic
993585408 5:89721087-89721109 CCAAGATTATTTTTGCCTTGAGG - Intergenic
993599573 5:89904007-89904029 CCAGAAGTATATTTTCCTTAAGG - Intergenic
994401555 5:99287066-99287088 GATGGCTTAGATTTTCCTTGGGG + Intergenic
995235633 5:109826548-109826570 CCGGGCTTATCTTTTCCCAGAGG - Intronic
995715346 5:115077205-115077227 ACAGGGCTATATTTTCTTTGTGG - Intergenic
997651201 5:135522739-135522761 CCAGGATTATATGTTTCCTGAGG - Intergenic
1000695914 5:164383392-164383414 CCAGGTTTATTTTTTTCTTCAGG + Intergenic
1003549081 6:7085905-7085927 CCAGGCTTGCATATCCCTTGGGG - Intergenic
1004589266 6:17032704-17032726 CGAGGCTTTTATTTGCCTTGAGG - Intergenic
1004784069 6:18946016-18946038 CTAGGCTTATATATACCTTGAGG + Intergenic
1005186414 6:23167272-23167294 CCATCCTTATGTTTTCCTTATGG + Intergenic
1006281293 6:33055599-33055621 CCATACATATATTTTCCTTATGG + Intergenic
1007405018 6:41630210-41630232 CATGGCTTATAGTTTGCTTGGGG + Intergenic
1007940447 6:45775768-45775790 GCAGGCTTATATTTCACATGGGG + Intergenic
1008150943 6:47950298-47950320 CCCAGCTTATATTTTCCATGTGG - Intronic
1008768391 6:54948253-54948275 CTATGCTAATATTTACCTTGTGG - Intergenic
1009268055 6:61580672-61580694 CCAGAGTTATTTTTTCCTTCTGG - Intergenic
1009665105 6:66668012-66668034 TCAAGCTTATACTTTTCTTGTGG - Intergenic
1010336801 6:74694970-74694992 CCGGGCTTATACTTGCCTAGTGG - Intergenic
1010573446 6:77505820-77505842 ACAGGATTATATTTCCATTGTGG - Intergenic
1011729870 6:90250150-90250172 CCAGACTTACTTTTTCCTTAAGG - Intronic
1012191027 6:96280012-96280034 CCATGATTGTATGTTCCTTGAGG + Intergenic
1012836181 6:104271162-104271184 CCAGGCTAATATTTTCCCTCTGG + Intergenic
1012946864 6:105475545-105475567 CCATGCTTATCATTTCTTTGTGG + Intergenic
1014365922 6:120541821-120541843 ACAGGCTTACATTGTCCTTTAGG - Intergenic
1015342641 6:132119379-132119401 CCAGGTTTAATTTTTCCTTGAGG - Intergenic
1015576601 6:134678471-134678493 CCGGGCTTATGTTTTCTTTAGGG + Intergenic
1018801268 6:167224084-167224106 CCAGCCTTAACTTTTCCTTTTGG - Intergenic
1019724948 7:2596630-2596652 ACACGCTTATAAATTCCTTGAGG - Intronic
1020262048 7:6536219-6536241 CCAGGGTAACATTCTCCTTGCGG + Intronic
1023470308 7:40510552-40510574 CCAGGATTATATTATATTTGAGG - Intronic
1025800184 7:64779820-64779842 CTAGGCTTATATTTCCCTGAAGG + Intergenic
1027599239 7:80218488-80218510 TGAGGCTTTTATTTCCCTTGAGG + Exonic
1028752724 7:94399510-94399532 TCAGGCTTACATTTTATTTGTGG + Intronic
1028860377 7:95642340-95642362 CCAGGCATAGATTGTCCCTGAGG + Intergenic
1030462023 7:109850681-109850703 CCAGGATTTTTTTTTCCTTTTGG - Intergenic
1030532579 7:110729287-110729309 CCAGGATTATAAGTTTCTTGAGG - Intronic
1030680408 7:112428017-112428039 CCAGGCTCACCTTTTCCTGGGGG - Intronic
1031175643 7:118345423-118345445 CCAGGCTCATTTTATCCTTTAGG - Intergenic
1031492226 7:122403298-122403320 CCAGTGTCATATTTTCCTTTTGG - Intronic
1032586880 7:133154978-133155000 CCAGGCTCATCTCTTCCCTGAGG + Intergenic
1033941624 7:146662094-146662116 CCATCCTTATCTTTTCTTTGGGG + Intronic
1034987264 7:155524026-155524048 GCAGGCTCATATTTTTCTTGGGG - Intronic
1035758471 8:2051646-2051668 CCAGGATTATATATATCTTGAGG - Intronic
1037333868 8:17773181-17773203 ACAGTCTTTTATTTTCCTTGGGG - Intronic
1038595703 8:28883877-28883899 CCAGGAGTGTATTTTCCATGTGG + Intronic
1040714380 8:50230693-50230715 CCAGGCTGATTTTTTGCATGTGG - Intronic
1042011526 8:64251052-64251074 CAAAGCATCTATTTTCCTTGAGG - Intergenic
1042390241 8:68226238-68226260 TCAGGTTTATACTCTCCTTGGGG - Intronic
1043611620 8:82070240-82070262 CCACCCTTATATCTTCATTGGGG + Intergenic
1047087248 8:121531905-121531927 CCAGGCATAGACTTTCCTGGTGG - Intergenic
1048033026 8:130651078-130651100 GCAGGCTTTTCTTTTCCTGGTGG + Intergenic
1048239118 8:132723696-132723718 CAGTGCTCATATTTTCCTTGAGG + Intronic
1048294677 8:133205666-133205688 CCAGGCTTTCATTTTCCTTGGGG - Intronic
1048502082 8:134987498-134987520 CCAGGATTGTAAGTTCCTTGAGG + Intergenic
1048761443 8:137799806-137799828 CCAGGCTTAACTTTTCCCTTTGG + Intergenic
1050968902 9:11843951-11843973 CAAGGCTGATAATTTCCTTTAGG + Intergenic
1051238557 9:15027175-15027197 CCATGTTTATTTCTTCCTTGAGG - Intergenic
1051520797 9:17985447-17985469 TCAAGATTTTATTTTCCTTGTGG - Intergenic
1051887492 9:21909550-21909572 TAAGGCATATATTTACCTTGTGG + Intronic
1052344309 9:27393258-27393280 CCTGGCCTATATTTACTTTGGGG - Intronic
1055796974 9:79985319-79985341 CCAGTCTGATAGTTTCCTCGAGG + Intergenic
1057868860 9:98702738-98702760 CCAGGCTTATCTTCTCCAGGAGG + Intronic
1059369311 9:113812855-113812877 CCTGGCTACTATCTTCCTTGGGG - Intergenic
1059982656 9:119790228-119790250 CCAGACTTTGATTTACCTTGAGG - Intergenic
1185976064 X:4721584-4721606 CCATTCTTCTATTTTGCTTGAGG - Intergenic
1185981666 X:4786293-4786315 CCAAGCTTAACTTTTCCTTGTGG + Intergenic
1187180860 X:16942444-16942466 CCAGAGTAATATTTTCCTTTTGG - Intergenic
1187503959 X:19863878-19863900 CCATGCTTTTATTTTCTTTGGGG + Intronic
1187548808 X:20280761-20280783 CCAGGCTGATAATATCCTTGTGG - Intergenic
1188991869 X:36830645-36830667 CCAGGCTTATGTTTTCCTACAGG + Intergenic
1190403965 X:50067711-50067733 CCAAGGTTATTTCTTCCTTGAGG + Intronic
1190973182 X:55372480-55372502 CCAGGATTTTATTTTTCTTATGG + Intergenic
1194530806 X:95045780-95045802 CTAGGCTTGTCTTTTCCTTCAGG - Intergenic
1195081403 X:101374932-101374954 CCATGGTAATATTTTCCTTGTGG + Intronic
1195759272 X:108228467-108228489 ACAAGCTTAAATGTTCCTTGAGG - Intronic
1197255141 X:124254781-124254803 CCAGATTTATATTGTCCATGAGG - Intronic
1197873739 X:131083491-131083513 CCTGCCTTAAATTTTCCCTGGGG - Intronic
1199939500 X:152611486-152611508 CAAGGTTTTTATCTTCCTTGTGG + Intergenic
1201257434 Y:12122764-12122786 CCAGTCTTTCATTTTCCTTCTGG + Intergenic
1201628201 Y:16038910-16038932 CCAGGATTATAATTTTCCTGAGG - Intergenic