ID: 977621435

View in Genome Browser
Species Human (GRCh38)
Location 4:99142154-99142176
Sequence CTGGTCAGCTTGGGAAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977621429_977621435 -4 Left 977621429 4:99142135-99142157 CCTCAAGGAAAATATAAGCCTGG 0: 1
1: 0
2: 1
3: 29
4: 211
Right 977621435 4:99142154-99142176 CTGGTCAGCTTGGGAAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977621435 Original CRISPR CTGGTCAGCTTGGGAAAAAT GGG Intronic
No off target data available for this crispr