ID: 977622363

View in Genome Browser
Species Human (GRCh38)
Location 4:99152139-99152161
Sequence CCTGATAAGAACCTTTTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977622363_977622366 13 Left 977622363 4:99152139-99152161 CCTTGTAAAAGGTTCTTATCAGG 0: 1
1: 0
2: 1
3: 13
4: 140
Right 977622366 4:99152175-99152197 TACTGTGCTATTAAGTTACAGGG 0: 1
1: 0
2: 4
3: 15
4: 168
977622363_977622365 12 Left 977622363 4:99152139-99152161 CCTTGTAAAAGGTTCTTATCAGG 0: 1
1: 0
2: 1
3: 13
4: 140
Right 977622365 4:99152174-99152196 ATACTGTGCTATTAAGTTACAGG 0: 1
1: 1
2: 3
3: 13
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977622363 Original CRISPR CCTGATAAGAACCTTTTACA AGG (reversed) Intronic
908025074 1:59942041-59942063 CGTGATAAGTGCCTTATACAGGG + Intergenic
909406198 1:75292146-75292168 CCTGAACAGAACCTTTACCAGGG - Intronic
911299464 1:96154434-96154456 CCAGTTAAGAACCCTGTACAGGG + Intergenic
912527849 1:110297991-110298013 CCTTATAAGAACCTTGTACATGG - Intergenic
912565174 1:110582386-110582408 CCTGAAAAGAACCCTGGACATGG + Intergenic
914980999 1:152414274-152414296 TGTGATGAGAACCTTTTATAGGG + Intergenic
916120819 1:161526305-161526327 CTTGCAAAGAACCTTTCACATGG - Exonic
916130586 1:161607932-161607954 CTTGCAAAGAACCTTTCACATGG - Intronic
916266627 1:162896630-162896652 TCTGATCAGAACATTTGACAGGG + Intergenic
918238952 1:182604836-182604858 ACTGATAAGTACCCTTTACGAGG + Intergenic
918526682 1:185472444-185472466 CCTGTTAACAACATTTTTCAAGG - Intergenic
918937186 1:190936571-190936593 CTTGAAGAGAACATTTTACAAGG - Intergenic
1064966800 10:21022308-21022330 GCTGAAAAGAAACTTTTACCAGG - Intronic
1066337405 10:34492683-34492705 CCTGATCAGAAACATTTACTTGG + Intronic
1070084700 10:73225753-73225775 CATGATAAGTACCCTATACAAGG + Intronic
1070978015 10:80621118-80621140 CCTGTTGAGAACCACTTACATGG - Intronic
1071377815 10:85028158-85028180 CCTGGTAAGGACCTTTTCAAGGG - Intergenic
1078406322 11:11073090-11073112 CCAGATATGAACCTTTGAAAGGG - Intergenic
1082974931 11:59061932-59061954 CCTGAGGAGCACCTTTTACCAGG + Intergenic
1082979357 11:59105666-59105688 CCTGAGGAGCACCTTTTACCAGG + Intergenic
1084197916 11:67535811-67535833 CCTGATAAGGACCTTCTCCAAGG - Intergenic
1086140637 11:83494984-83495006 ACTGATCAGACCCTTTTACATGG + Intronic
1086366959 11:86116877-86116899 CTTCATAAGAACCTTTTCAATGG - Intergenic
1086678787 11:89642186-89642208 CCGGATAAGATCGTTTTAAAAGG + Intergenic
1089115906 11:116094934-116094956 CCTAATAAAAAGCTTTAACAAGG - Intergenic
1089229666 11:116961259-116961281 CCTGATAAGACCACTTAACAGGG + Intronic
1089862263 11:121600308-121600330 CCTGATGAGAACTTTCAACATGG - Intronic
1091210753 11:133856358-133856380 TCTGATAAGACACTTGTACAAGG - Intergenic
1092702511 12:11247908-11247930 ACTGCCAAGACCCTTTTACAGGG + Intergenic
1094431096 12:30369933-30369955 CAGGTTAAGAACCTTGTACAGGG + Intergenic
1095881677 12:47144002-47144024 CCTGATAAAAATTTTTTGCAGGG - Intronic
1097391771 12:59024006-59024028 CCTGAAAAGAACCCTTTTAAAGG - Intergenic
1097529669 12:60782232-60782254 TCTGGTAAGAGCCTTTTTCATGG - Intergenic
1106442905 13:29794761-29794783 CCTGATAAATACATTTTGCATGG - Intronic
1106522564 13:30510732-30510754 CATGAAAAGAAGCTGTTACATGG + Intronic
1108337376 13:49458919-49458941 CATGCTAAGCACCTTTTATATGG - Intronic
1108981264 13:56518244-56518266 CCTTATTAGTACCTTTCACATGG - Intergenic
1113172035 13:107515428-107515450 CCTTATAACAACCTGTTATAAGG + Intronic
1115109343 14:29802683-29802705 CCTGATAAGATTCTTTTCCTTGG - Intronic
1116045106 14:39733896-39733918 CCTGATAGGAACCTCTACCAGGG - Intergenic
1117489079 14:56228122-56228144 CCTGAAATGAAAGTTTTACAGGG - Intronic
1121855932 14:97270312-97270334 CCTGACAGCAACCTTATACAGGG - Intergenic
1125298994 15:38234081-38234103 GCTGATATGAATCTTTTACAAGG + Intergenic
1126268801 15:46788006-46788028 CCTGAGAAAGACCTTTTACGTGG - Intergenic
1126710541 15:51450692-51450714 CCTGAAAAGAACTTTTTGTACGG - Intronic
1128486089 15:68090517-68090539 CTAGATATGAACCTGTTACATGG + Intronic
1130149757 15:81302432-81302454 CATGAGAAGAGCCTTCTACAAGG + Intronic
1137737655 16:50736912-50736934 CCTGAAAAGAAGCATTTTCAGGG - Intergenic
1141563070 16:84883180-84883202 CCAGAAAAGAACCTCTCACACGG - Intronic
1143926160 17:10372785-10372807 CCTTTCAAGAAACTTTTACAAGG - Intronic
1146327523 17:31899669-31899691 CCAGAGAAGAACCCTTTTCAAGG - Exonic
1148967261 17:51446646-51446668 GCTTATAAAAACCTTATACAGGG + Intergenic
1149380616 17:56089869-56089891 CATGATAATAACCTTGTACTTGG + Intergenic
1149913413 17:60586827-60586849 CCTGATGAGGACCTTGGACAGGG - Intergenic
1151291680 17:73155363-73155385 CCTGGCAAGACCCTTTTACTTGG - Intergenic
1153059956 18:984808-984830 TCTCATAACAACATTTTACATGG + Intergenic
1155644707 18:28063572-28063594 CCTAATAAAAACTTTTCACAGGG + Intronic
1155921072 18:31603449-31603471 TCTGAAAAAAACCTTTTAAAAGG - Intergenic
1158334144 18:56396353-56396375 GCTGATATAAACTTTTTACAAGG + Intergenic
1158862191 18:61603457-61603479 CCTGAACAGAACCTTTTCCAAGG - Intergenic
1159048302 18:63392119-63392141 CCAGAGGAGAAACTTTTACACGG - Intronic
1160105647 18:75972947-75972969 CATAATATGAACCTTTTAAAAGG - Intergenic
926113091 2:10195094-10195116 CCTGCTAAGTGCCTTTTCCAAGG - Intronic
927446362 2:23165537-23165559 CGTGATAAGAAGCTGTTGCAGGG + Intergenic
932434692 2:71696105-71696127 CCTGACCAGGAGCTTTTACAAGG - Intergenic
932989635 2:76771122-76771144 CCTGAAAAAAACTTTTTACAAGG + Intronic
934153471 2:89172445-89172467 TCTAGTCAGAACCTTTTACATGG - Intergenic
934213764 2:90009486-90009508 TCTAGTCAGAACCTTTTACATGG + Intergenic
935171571 2:100614532-100614554 CCTGCTAAGAATCTATTGCAAGG - Intergenic
936493771 2:112999404-112999426 CTTTAAAAGAACCTGTTACAAGG - Intergenic
939012574 2:136863805-136863827 ACTGATATTAACCTCTTACAAGG + Intronic
939910679 2:147978559-147978581 CCTGATAAGACACTTTAACTTGG - Intronic
942097777 2:172549578-172549600 TCTGATAAGAAACAGTTACAAGG + Intergenic
942748372 2:179262230-179262252 CCTAAAAAGAACCTTGTACCTGG - Intronic
943551538 2:189346358-189346380 CAGGATAAGATCCTTTTGCAAGG + Intergenic
1169904077 20:10582817-10582839 CCTGAAAATAACATTTTATAAGG - Intronic
1170109894 20:12793804-12793826 CTTGATAAAAATTTTTTACATGG - Intergenic
1172666291 20:36602697-36602719 CCTGAACAGACCCTTTTTCAAGG - Intronic
952084793 3:29805960-29805982 CCTGGTAAGTACCCTATACAGGG + Intronic
952715905 3:36480820-36480842 CCTGATGAAAACATTTTTCATGG - Intronic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
955467448 3:59252022-59252044 CTTGACAAGAAGCTTTTGCATGG - Intergenic
955858493 3:63300492-63300514 CCTGCTCAGATCCTTTTACTAGG + Intronic
956201317 3:66709205-66709227 AATGATAACTACCTTTTACAGGG + Intergenic
956216753 3:66857453-66857475 CCAGATAACAAGCTTTAACAGGG - Intergenic
956544484 3:70385285-70385307 TCTGATGAGTACCTCTTACATGG - Intergenic
959120380 3:102225065-102225087 CCTGATCAGTAGCTTTGACAAGG + Intronic
961638748 3:128351381-128351403 CCTAACAACAACCTTTTTCAAGG + Intronic
962452422 3:135531456-135531478 CCTGTTAGGTACCTTATACATGG + Intergenic
963910685 3:150815173-150815195 CCGGATAACAACCTTTTCAAGGG + Intergenic
964276248 3:155011751-155011773 TCTGATAAGAAACGTTTACAAGG - Intergenic
964924677 3:161940790-161940812 CCTTATAAAAACTTTTGACAGGG + Intergenic
966025723 3:175278598-175278620 CCAGAAAAGAACTTTTTATAAGG - Intronic
966994413 3:185265877-185265899 CCTGATAAGGACCCTTTTAAGGG - Intronic
972473867 4:39432594-39432616 CCTGATAAGAAACTTTCTGAGGG + Intronic
977121811 4:93111603-93111625 CATGACAATAAACTTTTACAAGG - Intronic
977622363 4:99152139-99152161 CCTGATAAGAACCTTTTACAAGG - Intronic
977860154 4:101948140-101948162 CCTGTTATGAACATTTTGCAAGG + Intronic
980941922 4:139282985-139283007 CCTGATAAGCATATTTTTCATGG + Intronic
983030326 4:162793137-162793159 GCTGATAAGAATCTCTTAGAAGG - Intergenic
984966743 4:185145940-185145962 CCCGAGGAGAACATTTTACAGGG + Intronic
986412322 5:7493278-7493300 CCTGCTGAGAACCTTTTGGAAGG - Intronic
987999967 5:25335210-25335232 CCTAATGATAACCTTTTAAAGGG + Intergenic
988030248 5:25754272-25754294 CTTGATAAGGACCTTTTTTAAGG + Intergenic
990361733 5:55027652-55027674 CCTAACAATAACCTTTTTCAAGG - Intronic
993381974 5:87218463-87218485 CCTGATGAAAACTTTTTACAGGG + Intergenic
993599318 5:89901219-89901241 CCTAATAAGAACTATTTCCATGG + Intergenic
999675408 5:153996541-153996563 TCTGATAAGAAACTTGTACTAGG + Intronic
1000132811 5:158316222-158316244 TCTGACAAGAACTTCTTACATGG + Intergenic
1001557243 5:172645164-172645186 CCTCATAACAACCCTTTAGAGGG + Intronic
1002351676 5:178588343-178588365 CCTGATACAACCATTTTACAAGG - Intronic
1003068114 6:2920457-2920479 TCTGATAAGAAACATTTACTTGG - Intergenic
1003895432 6:10603239-10603261 ATTGAAAACAACCTTTTACAAGG - Intronic
1004879301 6:19990872-19990894 TCTGATTAGAACCATTTAGAGGG - Intergenic
1009318684 6:62257095-62257117 AATGATAAGAACTTTTTCCAAGG + Intronic
1011207012 6:84910489-84910511 CCAGGTAAGAATCTTTTAAAAGG + Intergenic
1012395631 6:98793501-98793523 TATGATAAAAACCTATTACAAGG - Intergenic
1013148488 6:107419426-107419448 CCTAATAAGGACCTTTTTCTTGG - Intronic
1016561304 6:145397705-145397727 CTTGATAAGAGCCTTTTCAATGG - Intergenic
1016811311 6:148263706-148263728 CCTGAAAAGAAACTGTCACAGGG + Intergenic
1017233832 6:152099338-152099360 TCTGATAAGCACTTTTTAAATGG + Exonic
1018497618 6:164366110-164366132 CCTGATTAGGACATTTTACATGG - Intergenic
1019292818 7:258592-258614 CCTGTTAGGAACCTTGTACAGGG + Intronic
1021832091 7:24624543-24624565 TCTGAAAAATACCTTTTACAAGG + Intronic
1025639434 7:63353268-63353290 CCTCACCAGAGCCTTTTACATGG - Intergenic
1025643265 7:63394824-63394846 CCTCACCAGAGCCTTTTACATGG + Intergenic
1026582783 7:71632144-71632166 CCTGAAAAGATGCTCTTACAAGG + Intronic
1034882978 7:154776424-154776446 CCTGATAACCACATTTCACATGG + Intronic
1036750185 8:11438928-11438950 CCTCATAACAACCATTTCCAGGG - Intronic
1037341462 8:17849699-17849721 CCTGATAAGTATCATTTACCTGG - Intergenic
1045874877 8:106968726-106968748 TCTGCTAAGAAGCATTTACAAGG - Intergenic
1047836331 8:128697448-128697470 GCAGATATGGACCTTTTACAAGG + Intergenic
1048054442 8:130849925-130849947 CCTGCTAATAACCTTTTTCTTGG - Intronic
1050638679 9:7641817-7641839 CCTCAAAAGAGCCTTTGACAAGG - Intergenic
1052607129 9:30719124-30719146 TCTGAAAAGACCCTTTAACAAGG + Intergenic
1053495991 9:38548344-38548366 CCTCATAAGAAACTTCTACTAGG - Intronic
1053565627 9:39247654-39247676 CCTGATAAGTACATTTTAAAAGG - Intronic
1053831393 9:42085509-42085531 CCTGATAAGTACATTTTAAAAGG - Intronic
1054131522 9:61371382-61371404 CCTGATAAGTACATTTTAAAAGG + Intergenic
1054599154 9:67101929-67101951 CCTGATAAGTACATTTTAAAAGG + Intergenic
1055203120 9:73692256-73692278 CCTGCTAAGAACCATGGACAGGG + Intergenic
1056760139 9:89408702-89408724 CATGACAAGAACCCTTTCCAAGG - Intronic
1057382371 9:94580773-94580795 CCTGATAAGGGCCTTTTTTAGGG - Intronic
1057635647 9:96763693-96763715 CCTGATAAGAATTGTTTTCATGG - Intronic
1058527113 9:105870358-105870380 CCTGATAAGAATCATTCACTGGG - Intergenic
1188237297 X:27746538-27746560 TCTAATAAGAACATTTTCCAAGG + Intronic
1188809245 X:34632398-34632420 ACTGGTAATAATCTTTTACATGG - Intronic
1190078616 X:47337550-47337572 CATAATAAGAACTTTTTAAAAGG + Intergenic
1190491810 X:50990066-50990088 CCTGATAAGTGCCTGTTAAATGG - Intergenic
1193741068 X:85217529-85217551 ACTGAGATGAACCTTTTCCACGG - Intergenic
1194820513 X:98500781-98500803 CAGGATACCAACCTTTTACATGG + Intergenic
1196889015 X:120274625-120274647 TTTGATAAGACCCTTTTCCATGG - Intronic
1198745223 X:139882953-139882975 CCTGATAAGAAACTTCAACTTGG + Intronic
1199967476 X:152831905-152831927 GCTTATTAGAACCTTTTAAATGG + Intronic
1202026227 Y:20526806-20526828 TCTGGTAAAAACCTGTTACATGG - Intergenic