ID: 977623883

View in Genome Browser
Species Human (GRCh38)
Location 4:99168571-99168593
Sequence CTTGTAGGATACTTGAAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977623878_977623883 18 Left 977623878 4:99168530-99168552 CCTACTTTTATACCAGTACCATG 0: 35
1: 655
2: 970
3: 947
4: 1004
Right 977623883 4:99168571-99168593 CTTGTAGGATACTTGAAGTCTGG No data
977623880_977623883 0 Left 977623880 4:99168548-99168570 CCATGATGTTTGTTAACTATAAC No data
Right 977623883 4:99168571-99168593 CTTGTAGGATACTTGAAGTCTGG No data
977623879_977623883 6 Left 977623879 4:99168542-99168564 CCAGTACCATGATGTTTGTTAAC No data
Right 977623883 4:99168571-99168593 CTTGTAGGATACTTGAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977623883 Original CRISPR CTTGTAGGATACTTGAAGTC TGG Intergenic
No off target data available for this crispr