ID: 977626275

View in Genome Browser
Species Human (GRCh38)
Location 4:99192646-99192668
Sequence GATAGCTCTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977626275_977626278 11 Left 977626275 4:99192646-99192668 CCAGTAACAGGCCAAGAGCTATC No data
Right 977626278 4:99192680-99192702 GAGTAGTTATCTGCAGAAGATGG 0: 178
1: 192
2: 102
3: 110
4: 247
977626275_977626279 15 Left 977626275 4:99192646-99192668 CCAGTAACAGGCCAAGAGCTATC No data
Right 977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG 0: 185
1: 187
2: 104
3: 111
4: 225
977626275_977626280 16 Left 977626275 4:99192646-99192668 CCAGTAACAGGCCAAGAGCTATC No data
Right 977626280 4:99192685-99192707 GTTATCTGCAGAAGATGGCAGGG 0: 180
1: 172
2: 120
3: 86
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977626275 Original CRISPR GATAGCTCTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr