ID: 977634376

View in Genome Browser
Species Human (GRCh38)
Location 4:99280173-99280195
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 3, 1: 0, 2: 0, 3: 2, 4: 64}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977634376_977634378 -7 Left 977634376 4:99280173-99280195 CCAGTCAGTAGCAGCATAGGGTT 0: 3
1: 0
2: 0
3: 2
4: 64
Right 977634378 4:99280189-99280211 TAGGGTTCATTGAGAGGTTTTGG 0: 1
1: 0
2: 2
3: 9
4: 124
977634376_977634381 4 Left 977634376 4:99280173-99280195 CCAGTCAGTAGCAGCATAGGGTT 0: 3
1: 0
2: 0
3: 2
4: 64
Right 977634381 4:99280200-99280222 GAGAGGTTTTGGGAATCAGGAGG 0: 1
1: 1
2: 4
3: 21
4: 293
977634376_977634379 -6 Left 977634376 4:99280173-99280195 CCAGTCAGTAGCAGCATAGGGTT 0: 3
1: 0
2: 0
3: 2
4: 64
Right 977634379 4:99280190-99280212 AGGGTTCATTGAGAGGTTTTGGG 0: 1
1: 0
2: 3
3: 12
4: 168
977634376_977634380 1 Left 977634376 4:99280173-99280195 CCAGTCAGTAGCAGCATAGGGTT 0: 3
1: 0
2: 0
3: 2
4: 64
Right 977634380 4:99280197-99280219 ATTGAGAGGTTTTGGGAATCAGG 0: 1
1: 1
2: 1
3: 30
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977634376 Original CRISPR AACCCTATGCTGCTACTGAC TGG (reversed) Exonic
902980381 1:20118466-20118488 TACCCTTGGCTGCCACTGACAGG + Intronic
905603096 1:39270817-39270839 AGCCTTATGCTGCTAGTGATAGG - Intronic
905920196 1:41714182-41714204 AACCCTCTGATGTTACTGGCTGG + Intronic
906727614 1:48055361-48055383 TACCAGATGCTGCTTCTGACTGG - Intergenic
910375248 1:86561795-86561817 AACCCTATTCTATTACTGATAGG + Intronic
913416969 1:118619436-118619458 CTCCCTATGCTGCCACTGCCAGG + Intergenic
916425928 1:164679748-164679770 AAACCTATAGTGCTACTCACAGG - Intronic
918428470 1:184434632-184434654 AACCCAGTGCTGCCACTCACAGG - Intronic
1067750029 10:48965369-48965391 GACTCCATGCTGCTCCTGACAGG + Intronic
1068518020 10:58047955-58047977 ATCCCTATGAAGCTACTGAGGGG - Intergenic
1073544111 10:104334770-104334792 CACCCCATGCTGCTCCTGCCTGG + Intronic
1074855021 10:117467099-117467121 AACCCTATGGTGACAGTGACAGG - Intergenic
1081629343 11:44678082-44678104 AAGCCAATGCTGCTACCAACAGG + Intergenic
1084799820 11:71535987-71536009 AACCCAATGGCGGTACTGACAGG + Intronic
1090616900 11:128522720-128522742 AAAACTATGCTGCTACTGGGAGG - Intronic
1100155610 12:91796650-91796672 GACACTATGCTCCTAATGACTGG + Intergenic
1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG + Intronic
1119380086 14:74223005-74223027 AACCCTATTCTGCCCCTGCCTGG - Intergenic
1125172606 15:36783097-36783119 AACTGTATGCAGCTGCTGACAGG - Intronic
1127350549 15:58147710-58147732 AACCCTATGCTTCTATCAACAGG + Intronic
1131337535 15:91563649-91563671 AGCCCTCTTATGCTACTGACTGG - Intergenic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1145879782 17:28344668-28344690 CACCCCATGCTGCTGCTGCCTGG + Exonic
1148361150 17:47013511-47013533 AACCCTTTCCTGCTACAGCCTGG + Intronic
1148883865 17:50757118-50757140 AGCCCTATGCTCATACTGAGGGG - Intergenic
1158819601 18:61144355-61144377 ACCCCTTTGCTGCAACTGAGGGG + Intergenic
1162265222 19:9567807-9567829 AATCGAATGCTGCTACTGACAGG + Intronic
1163164709 19:15487932-15487954 ATGCCTATGCTGCTGCTTACTGG + Intronic
1166713890 19:44954473-44954495 ACCCTTGTGGTGCTACTGACTGG - Intergenic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
945822296 2:214679612-214679634 ACCCCTGTCTTGCTACTGACTGG - Intergenic
948754594 2:240151535-240151557 AGCCCTATGATGCTTCTGAGAGG + Intergenic
1168805157 20:668400-668422 ATACCTATCCTGCAACTGACAGG + Intronic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
951082383 3:18467382-18467404 AAGCCTATGCTGCTAGTTTCTGG - Intergenic
956953524 3:74310556-74310578 AACCCTATGCAGCTGTGGACAGG - Intronic
959632915 3:108529188-108529210 AATTCTAGGCTGCTACTGTCAGG + Intronic
960436388 3:117632227-117632249 AAGCATATGCTGCTTCTGAGGGG + Intergenic
961629136 3:128283515-128283537 AACCCTAGGCAGCTCCAGACTGG + Intronic
968831007 4:2933039-2933061 AACCCCATGGGGCTACTGGCTGG + Intronic
968925456 4:3544890-3544912 AAACCCATGCTGCTTCTGCCTGG - Intergenic
977634376 4:99280173-99280195 AACCCTATGCTGCTACTGACTGG - Exonic
977637054 4:99311550-99311572 AACCCTATGCTGCTACTGACTGG - Exonic
977639499 4:99340604-99340626 AACCCTATGCTGCTACTGACTGG - Exonic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
980724027 4:136734969-136734991 AACCATATGGTGATCCTGACAGG - Intergenic
982285057 4:153725419-153725441 AACCATATTCTGGTACTGGCAGG - Intronic
989117284 5:37967404-37967426 AACTTTATGCTGCTACTGGTTGG + Intergenic
989506432 5:42231281-42231303 AGCGCAGTGCTGCTACTGACTGG + Intergenic
995990759 5:118236314-118236336 AACCTCAAGCTGCTACTTACTGG + Intergenic
1003002863 6:2352236-2352258 TACCCTATGCTGCTGGTGAAAGG + Intergenic
1008135749 6:47774816-47774838 AACCCTCTGCTGATAATGAAAGG - Intergenic
1013317849 6:108958910-108958932 AACCCTGTGCTTCCACTCACTGG - Intronic
1015974575 6:138776208-138776230 AACCCTGTGCTTTTACTCACTGG - Exonic
1016859328 6:148700976-148700998 AGCCCTAGGCGGTTACTGACAGG - Intergenic
1017869443 6:158474356-158474378 AACCCTGTGCTGGCACTGCCTGG + Intronic
1020245170 7:6424051-6424073 AGCCCTCTTCTGCTCCTGACTGG - Intronic
1029863250 7:103598141-103598163 AAGACTATACTGCTACTGATAGG + Intronic
1037411471 8:18603015-18603037 AACCTAATGCAGCAACTGACAGG + Intronic
1051260230 9:15256750-15256772 AACCCTGTGCTGCTCCGGATTGG - Intronic
1053800347 9:41760072-41760094 AAACCCATGCTGCTTCTGCCTGG - Intergenic
1054144851 9:61554763-61554785 AAACCCATGCTGCTTCTGCCTGG + Intergenic
1054188774 9:61972224-61972246 AAACCCATGCTGCTTCTGCCTGG - Intergenic
1054464543 9:65485720-65485742 AAACCCATGCTGCTTCTGCCTGG + Intergenic
1054649747 9:67616393-67616415 AAACCCATGCTGCTTCTGCCTGG + Intergenic
1060660295 9:125401473-125401495 AAGCCCATACTGCTAATGACTGG - Intergenic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1188165381 X:26856578-26856600 ATCTCTATGCTGCCACTGAGTGG + Intergenic
1195095235 X:101495050-101495072 AACCATATGCTGATATTCACTGG - Exonic