ID: 977634378

View in Genome Browser
Species Human (GRCh38)
Location 4:99280189-99280211
Sequence TAGGGTTCATTGAGAGGTTT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 124}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977634373_977634378 3 Left 977634373 4:99280163-99280185 CCAGGTACGTCCAGTCAGTAGCA 0: 1
1: 1
2: 1
3: 1
4: 38
Right 977634378 4:99280189-99280211 TAGGGTTCATTGAGAGGTTTTGG 0: 1
1: 0
2: 2
3: 9
4: 124
977634372_977634378 7 Left 977634372 4:99280159-99280181 CCTTCCAGGTACGTCCAGTCAGT 0: 1
1: 1
2: 0
3: 0
4: 65
Right 977634378 4:99280189-99280211 TAGGGTTCATTGAGAGGTTTTGG 0: 1
1: 0
2: 2
3: 9
4: 124
977634376_977634378 -7 Left 977634376 4:99280173-99280195 CCAGTCAGTAGCAGCATAGGGTT 0: 3
1: 0
2: 0
3: 2
4: 64
Right 977634378 4:99280189-99280211 TAGGGTTCATTGAGAGGTTTTGG 0: 1
1: 0
2: 2
3: 9
4: 124
977634368_977634378 23 Left 977634368 4:99280143-99280165 CCACCAAGAATAGCTCCCTTCCA 0: 1
1: 0
2: 1
3: 12
4: 162
Right 977634378 4:99280189-99280211 TAGGGTTCATTGAGAGGTTTTGG 0: 1
1: 0
2: 2
3: 9
4: 124
977634370_977634378 20 Left 977634370 4:99280146-99280168 CCAAGAATAGCTCCCTTCCAGGT 0: 1
1: 1
2: 0
3: 7
4: 166
Right 977634378 4:99280189-99280211 TAGGGTTCATTGAGAGGTTTTGG 0: 1
1: 0
2: 2
3: 9
4: 124
977634371_977634378 8 Left 977634371 4:99280158-99280180 CCCTTCCAGGTACGTCCAGTCAG 0: 1
1: 1
2: 1
3: 5
4: 72
Right 977634378 4:99280189-99280211 TAGGGTTCATTGAGAGGTTTTGG 0: 1
1: 0
2: 2
3: 9
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977634378 Original CRISPR TAGGGTTCATTGAGAGGTTT TGG Exonic
903623367 1:24714134-24714156 AGTGGTTCATTGAGAGATTTTGG + Intergenic
906224947 1:44114019-44114041 TAGGGTGCATTGTAAGGTTGGGG + Intergenic
913479288 1:119271051-119271073 TAGGGATCATCCAGATGTTTGGG - Intergenic
918996927 1:191773638-191773660 TAGAGTTCATTGAGAGGAGCTGG - Intergenic
919939908 1:202279006-202279028 CAGGGTTGAATGAGTGGTTTAGG + Intronic
920071400 1:203305572-203305594 TCGGGCTCAGTGAGAGGTCTCGG - Exonic
920894719 1:210035253-210035275 TAGGGTTATTTGAGGGGTTTTGG + Intronic
921563022 1:216681201-216681223 GGGGGTTCATTCAGAGGTTTTGG - Intronic
921988683 1:221340475-221340497 TAGAGTTCATTAAGAGGTGCTGG + Intergenic
923817284 1:237395095-237395117 TACGATTCAATGTGAGGTTTGGG + Intronic
1065583491 10:27194661-27194683 TAGGGTTCATTGTGTGGCTGTGG + Intergenic
1065880449 10:30033177-30033199 CAGGGTTAATTGAGCGTTTTAGG - Intronic
1067270333 10:44786093-44786115 CTGGGTTCATTGAGAAGTGTGGG - Intergenic
1075437261 10:122454192-122454214 TAAGGGTCAATGAGAGTTTTGGG - Intergenic
1078607739 11:12791901-12791923 TATGGTGCATTTAGATGTTTTGG - Intronic
1078657357 11:13254090-13254112 TAGGGAACATGGAGAGGGTTTGG - Intergenic
1079276894 11:19047936-19047958 TGGGCTTTGTTGAGAGGTTTAGG - Intergenic
1079914909 11:26357036-26357058 TAAGGTTAATTCACAGGTTTTGG + Intronic
1085850779 11:80117134-80117156 GAGGGTTCAGTGAGGAGTTTTGG - Intergenic
1089128223 11:116192261-116192283 TTGGGTTCATTGGGTGGTGTTGG + Intergenic
1090989002 11:131799485-131799507 TAGGATTCATGAAGAGGTCTGGG + Intronic
1095560328 12:43557018-43557040 TGGAGTTCATTGAGTGTTTTGGG + Intergenic
1097124042 12:56759037-56759059 TTGGGGTCATTGAGTGGTTGGGG + Intronic
1097381523 12:58901065-58901087 TTTAGTACATTGAGAGGTTTTGG - Intronic
1097390575 12:59007450-59007472 TAGGGATCATTTAAAGGTCTTGG + Intergenic
1098070286 12:66667461-66667483 TAGGGATCATTGACATCTTTTGG - Intronic
1098583423 12:72128924-72128946 TAGCGTTCTTTGAAATGTTTAGG - Intronic
1099308051 12:80982883-80982905 TTGGGTCCATTCAGATGTTTGGG - Intronic
1099505840 12:83475132-83475154 TAGGATTGATGGGGAGGTTTTGG + Intergenic
1101330557 12:103754463-103754485 TAGGGTTGATTGAGAGTTAAAGG + Intronic
1103224017 12:119271202-119271224 CTGGGTTCATTGAGAAATTTGGG - Intergenic
1108749343 13:53431357-53431379 CAGGGTTCATTGACAGTTGTAGG + Intergenic
1112947871 13:104954666-104954688 AAGGGGTAATTGAGCGGTTTAGG + Intergenic
1114156619 14:20110566-20110588 TAGGGTGATTGGAGAGGTTTTGG - Intergenic
1117757120 14:58986916-58986938 AAGGCTACATTCAGAGGTTTGGG + Intergenic
1117868652 14:60175227-60175249 TAGGGATGATTCTGAGGTTTGGG - Intergenic
1120520105 14:85517412-85517434 TAAGGTAAATTGAAAGGTTTTGG - Intergenic
1125738492 15:41944902-41944924 TAGGGTTTATTTAAAGGTTGGGG - Intronic
1134411150 16:14004033-14004055 GAGGGTTCGTTGGGTGGTTTTGG + Intergenic
1137881682 16:52055508-52055530 TATGATTAATTGAGAGGTTTAGG - Intronic
1143590227 17:7881511-7881533 AAGGGGTTACTGAGAGGTTTAGG + Intronic
1143746291 17:8996592-8996614 TATTGTTCATTTAGAGATTTGGG + Intergenic
1144217062 17:13065649-13065671 TAGGGCACATTGAGGGGTTGTGG + Intergenic
1146625315 17:34430886-34430908 TAAGGTTAAATGAGAGGATTAGG + Intergenic
1146675191 17:34768442-34768464 CAGGGTTCATTCAGAGGATAAGG - Intergenic
1146692181 17:34884082-34884104 TGGGTCTCATTGGGAGGTTTGGG + Intergenic
1146830388 17:36064129-36064151 TATGGTTACTTGAAAGGTTTAGG - Intergenic
1147999384 17:44378867-44378889 TCGGGTTTATTTGGAGGTTTGGG + Intronic
1151977051 17:77489029-77489051 TAGGGGTCAGTGTGAGGCTTTGG - Intronic
1156447454 18:37248204-37248226 CAGGGTTCATTTTGAGATTTAGG + Intronic
1159451278 18:68605266-68605288 TAATGGTCATTGAGAGCTTTTGG - Intergenic
1160316990 18:77857665-77857687 TTGGATTCACTGAGAGGCTTGGG - Intergenic
1163154005 19:15430215-15430237 TTAGGGTCATTGTGAGGTTTGGG - Intronic
1164801996 19:31084784-31084806 AAGGGCACATTGACAGGTTTTGG - Intergenic
1165305186 19:34999338-34999360 AAGGGTTGATGGAGAGGGTTGGG + Intronic
1166418692 19:42616367-42616389 TAGGATTATTTGAGATGTTTAGG + Intronic
1167200777 19:48063622-48063644 AAGGGTTCATTCAGATGGTTGGG - Intronic
925879350 2:8339093-8339115 TAGGATACATTGAAAGGCTTGGG + Intergenic
926567067 2:14487917-14487939 TATCATTCATTGAGAGCTTTGGG - Intergenic
926809989 2:16747463-16747485 TTAGCTTCATTGAGATGTTTGGG - Intergenic
927371269 2:22357972-22357994 TAGGGTTTATTGAGCTGCTTTGG + Intergenic
927636769 2:24822341-24822363 TAGGGTTTATTGAGAAAGTTCGG - Exonic
930407393 2:50976282-50976304 TAGAGTTCTTTTAGAGTTTTAGG - Intronic
931764052 2:65438938-65438960 GGGGGCTCATTGAGAGGTCTAGG + Intergenic
935811856 2:106806330-106806352 TTGGTTTCAATGACAGGTTTTGG - Exonic
942841131 2:180362162-180362184 TAGGGATCATTGAGAAAATTTGG - Intergenic
943469625 2:188277440-188277462 TAGGATTGTTTTAGAGGTTTGGG - Intergenic
946985794 2:225271428-225271450 TAGGGTACAATGTGATGTTTTGG - Intergenic
1169334281 20:4742550-4742572 TAGGGCCCACTGGGAGGTTTGGG + Intergenic
1170857222 20:20068392-20068414 AAGGGTTCAGTGAGAAGTTGTGG + Intronic
1174336653 20:49866612-49866634 TTGGGTTCATTGAGTTTTTTGGG + Intronic
1177397969 21:20562169-20562191 TAGGGTAAATTAAGAAGTTTGGG - Intergenic
1178448458 21:32667713-32667735 TAAGGTTCATTGAGAAGATGAGG - Intronic
1181554549 22:23661004-23661026 TAGGTTTTATCCAGAGGTTTTGG - Intergenic
1184037969 22:41927400-41927422 TCGGGGTCATGGAGAGGCTTTGG - Intergenic
951590776 3:24262047-24262069 TAGAGTTCAAGGAGAGGTCTGGG - Intronic
953278287 3:41526113-41526135 AAGAGTTCAATGAGAGGTTCAGG - Intronic
956413789 3:69005891-69005913 TTGTGTTCATTGGGAGTTTTGGG - Intronic
957706041 3:83785811-83785833 AAGGGTTCATTGTGATGTGTTGG - Intergenic
957761157 3:84558619-84558641 TAGGGTTCATTTAGAAATTATGG - Intergenic
959600446 3:108177381-108177403 TAGGGATCTTTGTCAGGTTTGGG - Intronic
960796260 3:121491714-121491736 TAGAGGTCAGTGAGAGATTTGGG - Intronic
961089285 3:124095790-124095812 TTGGCTTCTTTAAGAGGTTTTGG + Intronic
963203093 3:142604320-142604342 CAGGAGTCTTTGAGAGGTTTTGG - Intronic
971001293 4:22325764-22325786 TATAGTACATTGTGAGGTTTGGG - Intergenic
971116293 4:23649548-23649570 TAGAGTTCATTGGGAAGTTTTGG - Intergenic
971984423 4:33803060-33803082 AAGGGTTTATTGAGATATTTTGG + Intergenic
976650406 4:87427812-87427834 TAGGGTTCAATTAGAGATTAGGG + Intronic
977634378 4:99280189-99280211 TAGGGTTCATTGAGAGGTTTTGG + Exonic
977637056 4:99311566-99311588 TAGGGTTTATTGAGAGGTTCTGG + Exonic
977639501 4:99340620-99340642 TAGGGTTTATTGAGAGGTTCTGG + Exonic
979228326 4:118317350-118317372 TATGTTTCATTGAGAGTTTTTGG - Intronic
980668949 4:135978567-135978589 TGGTGTTCATTTAGAGCTTTTGG - Intergenic
980966844 4:139529994-139530016 TAGGGGTCATTGAGTACTTTAGG + Intronic
983270478 4:165555637-165555659 TAGGGTACAATGTGATGTTTTGG - Intergenic
984162066 4:176265102-176265124 TAGGAGTCATTGAAAGTTTTTGG - Intronic
984562200 4:181283943-181283965 TCGGGTTCACTGAGAGATGTTGG - Intergenic
995833146 5:116375657-116375679 TCTGGTTAATTGAGAGGTATGGG + Intronic
1003500123 6:6696364-6696386 TAGGGTGCTTTGGGAGGTCTGGG + Intergenic
1006515156 6:34541569-34541591 TCTGGTTCCTTGAGGGGTTTGGG - Intronic
1006963111 6:37954219-37954241 TGGAGTTCATTGAGATTTTTTGG + Intronic
1007283020 6:40726183-40726205 AAGGGCTCATTTAGAGGTTTGGG - Intergenic
1009326679 6:62358803-62358825 AAGGGAGCATTGACAGGTTTGGG - Intergenic
1010360195 6:74984600-74984622 TTGGCTTATTTGAGAGGTTTGGG + Intergenic
1013569899 6:111411697-111411719 TAGGTTTAACTGAAAGGTTTGGG - Intronic
1013697266 6:112718373-112718395 TAAACTTCATTGAGAGATTTGGG - Intergenic
1015058445 6:128932981-128933003 TTGGGGTAAATGAGAGGTTTGGG - Intronic
1018457369 6:163964103-163964125 CAGGGTTCAATGTGATGTTTTGG - Intergenic
1018750881 6:166804257-166804279 TAAAGTTCAATGAGAGGTGTAGG + Intronic
1018750897 6:166804580-166804602 TAAAGTTCAATGAGAGGTCTAGG + Intronic
1021157750 7:17232631-17232653 TTGGTTCCATTGAGAGGTATTGG + Intergenic
1027859203 7:83553664-83553686 TAGGGTTAACTAAAAGGTTTTGG + Intronic
1028157337 7:87446133-87446155 CAGACTTCATTGAGAGGTTGTGG - Intronic
1028254339 7:88575228-88575250 TTGGGTTCACAGAGATGTTTCGG + Intergenic
1029839379 7:103345975-103345997 TAGGGATCAGGAAGAGGTTTTGG - Intronic
1030296435 7:107933120-107933142 TGGTGATCTTTGAGAGGTTTTGG - Intronic
1033153303 7:138935225-138935247 TAGGCTTCATGGTGGGGTTTGGG + Intronic
1034348437 7:150401281-150401303 TCGGCCTCATTGAGAGGGTTTGG + Intronic
1035775945 8:2188349-2188371 TGGGATACATTGAAAGGTTTTGG + Intergenic
1036465710 8:8994989-8995011 TGGGGTCCATTCAGAAGTTTGGG - Intergenic
1043448556 8:80342988-80343010 TAGACTTCAGGGAGAGGTTTAGG - Intergenic
1050405239 9:5301930-5301952 TTTGGTTAAATGAGAGGTTTTGG + Intronic
1053091389 9:35280997-35281019 TAGGTTTCATTGGGAGGCTGAGG + Intronic
1054965710 9:71024995-71025017 CAGGGTTCAGTGAGAGGTATTGG - Intronic
1058395624 9:104550413-104550435 TAGGGTTCATCGAGAAATTTTGG + Intergenic
1058784937 9:108377665-108377687 AAGGGTTCATTTAGATGGTTGGG + Intergenic
1061430915 9:130530368-130530390 TTGAGTTCATTGAAAGGGTTAGG - Intergenic
1061510899 9:131060317-131060339 TTTGGTTCAGAGAGAGGTTTCGG + Intronic
1061872902 9:133530139-133530161 TTTGGTTCACTGAGAGGTGTGGG - Intergenic
1185923704 X:4123423-4123445 TTGGGTTGATGGAGATGTTTTGG - Intergenic
1190872389 X:54435149-54435171 AAGGGTTCATTCAGAGGCCTTGG + Intergenic
1192547234 X:72024128-72024150 TAGGGGTCAGGGAGGGGTTTAGG - Intergenic
1194129887 X:90068626-90068648 TAGGGTTTTTTTAGAGGTTTTGG + Intergenic
1195710606 X:107770680-107770702 TAGAGCTGATTAAGAGGTTTTGG + Intronic
1201855255 Y:18534370-18534392 TAGGGTTCAGTGTTAGTTTTAGG + Intergenic
1201878067 Y:18786015-18786037 TAGGGTTCAGTGTTAGTTTTAGG - Intronic