ID: 977634379

View in Genome Browser
Species Human (GRCh38)
Location 4:99280190-99280212
Sequence AGGGTTCATTGAGAGGTTTT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 168}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977634368_977634379 24 Left 977634368 4:99280143-99280165 CCACCAAGAATAGCTCCCTTCCA 0: 1
1: 0
2: 1
3: 12
4: 162
Right 977634379 4:99280190-99280212 AGGGTTCATTGAGAGGTTTTGGG 0: 1
1: 0
2: 3
3: 12
4: 168
977634371_977634379 9 Left 977634371 4:99280158-99280180 CCCTTCCAGGTACGTCCAGTCAG 0: 1
1: 1
2: 1
3: 5
4: 72
Right 977634379 4:99280190-99280212 AGGGTTCATTGAGAGGTTTTGGG 0: 1
1: 0
2: 3
3: 12
4: 168
977634373_977634379 4 Left 977634373 4:99280163-99280185 CCAGGTACGTCCAGTCAGTAGCA 0: 1
1: 1
2: 1
3: 1
4: 38
Right 977634379 4:99280190-99280212 AGGGTTCATTGAGAGGTTTTGGG 0: 1
1: 0
2: 3
3: 12
4: 168
977634376_977634379 -6 Left 977634376 4:99280173-99280195 CCAGTCAGTAGCAGCATAGGGTT 0: 3
1: 0
2: 0
3: 2
4: 64
Right 977634379 4:99280190-99280212 AGGGTTCATTGAGAGGTTTTGGG 0: 1
1: 0
2: 3
3: 12
4: 168
977634370_977634379 21 Left 977634370 4:99280146-99280168 CCAAGAATAGCTCCCTTCCAGGT 0: 1
1: 1
2: 0
3: 7
4: 166
Right 977634379 4:99280190-99280212 AGGGTTCATTGAGAGGTTTTGGG 0: 1
1: 0
2: 3
3: 12
4: 168
977634372_977634379 8 Left 977634372 4:99280159-99280181 CCTTCCAGGTACGTCCAGTCAGT 0: 1
1: 1
2: 0
3: 0
4: 65
Right 977634379 4:99280190-99280212 AGGGTTCATTGAGAGGTTTTGGG 0: 1
1: 0
2: 3
3: 12
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977634379 Original CRISPR AGGGTTCATTGAGAGGTTTT GGG Exonic
904282422 1:29430115-29430137 TGGGTCCATTGGGAGGTGTTTGG - Intergenic
906640134 1:47436886-47436908 AGGGTTCACTGAGGGGGTGTCGG + Exonic
907049974 1:51323412-51323434 GGGGTTGATTGAGAGATGTTAGG - Intronic
912487111 1:110037738-110037760 AGGATACTCTGAGAGGTTTTAGG + Intronic
916915738 1:169404619-169404641 TTAGTTCATTGAGAGTTTTTAGG - Intronic
917504052 1:175612304-175612326 ATGGGTCATTGAGAGCTTTGAGG - Intronic
919939909 1:202279007-202279029 AGGGTTGAATGAGTGGTTTAGGG + Intronic
921563021 1:216681200-216681222 GGGGTTCATTCAGAGGTTTTGGG - Intronic
921988684 1:221340476-221340498 AGAGTTCATTAAGAGGTGCTGGG + Intergenic
922877882 1:228954661-228954683 AAAGTTTATTGAGAAGTTTTAGG - Intergenic
1064576053 10:16747485-16747507 AAGGTTAACTGTGAGGTTTTTGG - Intronic
1065583492 10:27194662-27194684 AGGGTTCATTGTGTGGCTGTGGG + Intergenic
1067270332 10:44786092-44786114 TGGGTTCATTGAGAAGTGTGGGG - Intergenic
1067852601 10:49763497-49763519 AGGGTTCATTGGGAATTCTTTGG + Intergenic
1068112702 10:52698611-52698633 AGAGGCCATTGAGAGGTGTTTGG - Intergenic
1068226661 10:54115222-54115244 AGGGTTCACTTAAAGGGTTTTGG + Intronic
1069682116 10:70292591-70292613 TGGGTGCAATGAGAGCTTTTTGG + Intergenic
1070759597 10:79015688-79015710 AGGTCTCATGGAGATGTTTTGGG + Intergenic
1070891853 10:79947008-79947030 AGGGTTCATTGAGTGCCTCTGGG + Intronic
1071021035 10:81056687-81056709 AGTGTTTATTGAGACATTTTAGG + Intergenic
1078657356 11:13254089-13254111 AGGGAACATGGAGAGGGTTTGGG - Intergenic
1079914910 11:26357037-26357059 AAGGTTAATTCACAGGTTTTGGG + Intronic
1080062614 11:27973008-27973030 AGGGTGAATTGAGAGGTGCTTGG + Intergenic
1080287284 11:30629919-30629941 AGGTTTCATTCACAGGTTCTGGG + Intergenic
1081365564 11:42230833-42230855 AGGGGTCTGTGAGAGGTTTCAGG + Intergenic
1081755933 11:45544439-45544461 AGGGTTTATTGAAAGGTGTCTGG - Intergenic
1085850778 11:80117133-80117155 AGGGTTCAGTGAGGAGTTTTGGG - Intergenic
1085877919 11:80431168-80431190 AGGGTACATTTAGAGGATATAGG - Intergenic
1086522257 11:87682834-87682856 AGGTCACATTCAGAGGTTTTGGG + Intergenic
1090876965 11:130798832-130798854 AGGGGTCTTTGAGAGGTAATAGG + Intergenic
1092162581 12:6324185-6324207 AGGGTTGCTGGAGAGGCTTTGGG + Intronic
1092162737 12:6324790-6324812 CGGGTTTCTTGAGAGGCTTTGGG + Intronic
1094614239 12:32022049-32022071 AGGGGTCCTTGGGAAGTTTTCGG + Intergenic
1098782996 12:74711379-74711401 AGGGTTCTTTGAGACACTTTTGG + Intergenic
1103836455 12:123824887-123824909 AGGCTTCATTCTGAGGTTCTGGG + Intronic
1105366193 13:19767440-19767462 TGGGATCATTCAGATGTTTTAGG - Intronic
1105561998 13:21500882-21500904 AGTTTTCTTTGAAAGGTTTTGGG + Intronic
1106334064 13:28766492-28766514 AGGGGTGACTGAAAGGTTTTAGG + Intergenic
1107431814 13:40347013-40347035 TGGGATCCATGAGAGGTTTTGGG - Intergenic
1108749344 13:53431358-53431380 AGGGTTCATTGACAGTTGTAGGG + Intergenic
1109771617 13:66982001-66982023 AGGGTCTAGTGAGAGGTGTTTGG + Intronic
1112947872 13:104954667-104954689 AGGGGTAATTGAGCGGTTTAGGG + Intergenic
1116040787 14:39684306-39684328 AGGGTCCATTGACAGGCTTCAGG + Intergenic
1117757121 14:58986917-58986939 AGGCTACATTCAGAGGTTTGGGG + Intergenic
1123115392 14:105892088-105892110 AGGGCTCACTGAGGGGCTTTTGG + Intergenic
1123119645 14:105910806-105910828 AGGGCTCACTGAGGGGCTTTTGG + Intergenic
1125020660 15:34983116-34983138 AGGTTTCATTGTGAAGTTGTTGG + Exonic
1129181417 15:73879618-73879640 AGAGTTGATTCAGAGGGTTTGGG - Intronic
1130199487 15:81811632-81811654 AGGGTTTATTCAGAGGTATCTGG - Intergenic
1130246426 15:82254113-82254135 AGAGGTCATTGATAGCTTTTAGG - Intronic
1130454199 15:84088846-84088868 AGAGGTCATTGATAGCTTTTAGG + Intergenic
1131646346 15:94349350-94349372 TGTGCTCAGTGAGAGGTTTTGGG - Intronic
1132126345 15:99229186-99229208 TGGGGTCATTGAGAGCTGTTTGG - Intronic
1137881681 16:52055507-52055529 ATGATTAATTGAGAGGTTTAGGG - Intronic
1138603687 16:58073425-58073447 AGGTTACATTCATAGGTTTTGGG - Intergenic
1141473410 16:84254792-84254814 TGGGATCTTTGAGAGATTTTTGG + Intergenic
1143143077 17:4753902-4753924 AGGGTGCAATGAAAGGATTTGGG - Intergenic
1143324597 17:6090569-6090591 TAGTTTCATTGAGAGGTTGTGGG - Intronic
1143590228 17:7881512-7881534 AGGGGTTACTGAGAGGTTTAGGG + Intronic
1144217063 17:13065650-13065672 AGGGCACATTGAGGGGTTGTGGG + Intergenic
1145883519 17:28368072-28368094 AGGGGTGAATGAGAGGTCTTGGG + Intronic
1146675190 17:34768441-34768463 AGGGTTCATTCAGAGGATAAGGG - Intergenic
1148783906 17:50135913-50135935 AGGGAGCATTGAGAGGCTTTTGG - Intronic
1151870515 17:76833584-76833606 AGGGTCCATTGTGAGGGGTTCGG + Intergenic
1153149519 18:2075142-2075164 AATTCTCATTGAGAGGTTTTGGG - Intergenic
1153431593 18:5023253-5023275 AGGCATCATTGGGAGGTCTTGGG + Intergenic
1156447455 18:37248205-37248227 AGGGTTCATTTTGAGATTTAGGG + Intronic
1160362495 18:78295808-78295830 AGGGTTGATTGACATGTTATAGG - Intergenic
1167200776 19:48063621-48063643 AGGGTTCATTCAGATGGTTGGGG - Intronic
1168287094 19:55340438-55340460 AGGGGTCAGGGAGAGGTTCTAGG - Intronic
925696110 2:6580896-6580918 AGGGTTCATTCACAGGTATCAGG + Intergenic
926028875 2:9568416-9568438 AGGGTTCCATGAGAGGGTTCAGG - Intergenic
927697824 2:25250158-25250180 GGGGTCCATTGACAGGCTTTGGG - Intronic
928290875 2:30036327-30036349 AGGGTTCAGTGAGAAGATTAAGG - Intergenic
930165630 2:48201167-48201189 AGGTTTCTATGAGAGGTTCTTGG - Intergenic
931412694 2:62048578-62048600 ATTGTTCATTGAGAGATTTTAGG + Intronic
931739478 2:65228606-65228628 ATGTTCCATTGAGTGGTTTTGGG + Intronic
931994351 2:67825416-67825438 AGAGAGCCTTGAGAGGTTTTAGG - Intergenic
932011951 2:67987561-67987583 AGTGTGCATGGAGAGGTGTTAGG + Intergenic
932248976 2:70223179-70223201 AGGATTGATTCATAGGTTTTAGG - Intronic
933527279 2:83457610-83457632 ACTGTTCATTCAGAGGTTCTGGG - Intergenic
934179073 2:89603739-89603761 ATAGTTCACTAAGAGGTTTTAGG + Intergenic
937947101 2:127350151-127350173 CTGGTTCAGTGAGATGTTTTAGG - Intronic
939887254 2:147694562-147694584 TGGGTAGATTGAGGGGTTTTTGG - Intergenic
941436436 2:165479024-165479046 AGGGTTTAATGAGAATTTTTTGG - Intronic
944579845 2:201122830-201122852 AGGGAACATTGAGATATTTTTGG + Intronic
1170857223 20:20068393-20068415 AGGGTTCAGTGAGAAGTTGTGGG + Intronic
1173795914 20:45859723-45859745 AGGGACCATTGTGAGGTGTTTGG + Intronic
1174712525 20:52722464-52722486 AGGGTTCTTTGAAAGCATTTGGG - Intergenic
1179490557 21:41738571-41738593 TGGGTTCATTCAGACCTTTTGGG - Intergenic
1181554548 22:23661003-23661025 AGGTTTTATCCAGAGGTTTTGGG - Intergenic
1182118713 22:27773265-27773287 GGGGTTCATTCAGCTGTTTTCGG + Intronic
1183243987 22:36679384-36679406 AGGGCTCCTGGAGAGGTTATAGG + Intronic
949870764 3:8586427-8586449 AGGGTTCAGCCAGAGGCTTTTGG + Intergenic
950905500 3:16534139-16534161 AGGGCTTAATGAGAGGTGTTTGG - Intergenic
954497588 3:50979377-50979399 AGGGCTCAGTGGGAGGTGTTTGG + Intronic
954758644 3:52857908-52857930 AAGGTTTAATGAGAGCTTTTTGG + Intronic
955061509 3:55496211-55496233 CTGATTCATTGAGAGATTTTGGG - Intergenic
956556425 3:70528296-70528318 AGGGTTTAATGGGAGGTGTTTGG - Intergenic
957456645 3:80460037-80460059 GGGGTCCAGTGAGAGGTATTTGG + Intergenic
957706040 3:83785810-83785832 AGGGTTCATTGTGATGTGTTGGG - Intergenic
958811270 3:98862679-98862701 ATGATTTATTGAGAGTTTTTAGG - Intronic
961113098 3:124302084-124302106 GAGGTTGATTGACAGGTTTTAGG - Intronic
966955899 3:184878407-184878429 AGGCTTCATTAAGATCTTTTAGG - Intronic
970233952 4:13939814-13939836 ATGGTTCATTGTGAGGACTTTGG + Intergenic
970423169 4:15923888-15923910 AGGCTCCATTGAGGGGTTTTAGG - Intergenic
970592342 4:17570387-17570409 AGGGGTCCTTGGGAAGTTTTTGG - Intergenic
971513413 4:27456257-27456279 AGGGCTAATTGGGAGGTTCTGGG - Intergenic
971984424 4:33803061-33803083 AGGGTTTATTGAGATATTTTGGG + Intergenic
974974572 4:68874265-68874287 AGGGTTCATTCAGATGATTGCGG - Intergenic
975173066 4:71255386-71255408 AGTACTCACTGAGAGGTTTTAGG - Exonic
976218002 4:82732690-82732712 AGGAGTCAATGAGAGGTTCTGGG + Intronic
976231626 4:82849931-82849953 AGGGATCATTTAAATGTTTTAGG + Intronic
976926773 4:90508065-90508087 TGGTTTCATTGTGTGGTTTTAGG + Intronic
977101910 4:92826940-92826962 AGAGTTCATTGATATGTTTCAGG + Intronic
977634379 4:99280190-99280212 AGGGTTCATTGAGAGGTTTTGGG + Exonic
977637057 4:99311567-99311589 AGGGTTTATTGAGAGGTTCTGGG + Exonic
977639502 4:99340621-99340643 AGGGTTTATTGAGAGGTTCTGGG + Exonic
978739417 4:112120204-112120226 AGGGTTGATTGAAAGGCTTGTGG - Intergenic
982325656 4:154126131-154126153 GGGGCTCATTAAGAGCTTTTGGG + Intergenic
986578712 5:9240716-9240738 AGGCTTGATTAAGAGGTATTTGG - Intronic
989047787 5:37289594-37289616 AGCATGCTTTGAGAGGTTTTAGG - Exonic
990729510 5:58793144-58793166 AGGGCCCACTGAGAGGTTTGAGG - Intronic
992164781 5:74038714-74038736 AGGGTTCATTCAGATGGTTGAGG - Intergenic
993820896 5:92615335-92615357 ACAGTTCCTTGAGAGGTTCTAGG - Intergenic
997337166 5:133116539-133116561 AGGGTTTCTTTAGAGGTTCTGGG + Intergenic
998369780 5:141653605-141653627 GGGGTTCCATGAGAGATTTTGGG - Exonic
998986785 5:147766959-147766981 CGATCTCATTGAGAGGTTTTTGG - Intronic
1000785725 5:165541052-165541074 AGGTTTCCTTGAGAGGTGTGAGG + Intergenic
1005129361 6:22486966-22486988 AGGGTTCAAAGCCAGGTTTTAGG + Intergenic
1005496295 6:26391005-26391027 AGGGTTCATTAAGAGCTGCTGGG - Intronic
1006572685 6:35018445-35018467 AGGGTTAGTTGAGAGGTGTGAGG + Intronic
1007283019 6:40726182-40726204 AGGGCTCATTTAGAGGTTTGGGG - Intergenic
1012333033 6:98017501-98017523 TGGGTTGTGTGAGAGGTTTTAGG + Intergenic
1017961755 6:159229009-159229031 TGGGTTCATTGAGAGGAAATAGG + Intronic
1018436170 6:163761135-163761157 AGGGTTCATGTAGAGTGTTTAGG + Intergenic
1021157751 7:17232632-17232654 TGGTTCCATTGAGAGGTATTGGG + Intergenic
1022235846 7:28459488-28459510 AGGGTCCATGGAGTGATTTTAGG + Intronic
1023091929 7:36625426-36625448 AGGGTTTATTGGGAGGATTAAGG + Intronic
1023567988 7:41542459-41542481 AGGGCTCATGGAGAGTTTTGAGG - Intergenic
1028157336 7:87446132-87446154 AGACTTCATTGAGAGGTTGTGGG - Intronic
1029211928 7:98916401-98916423 TGGGTTCATTGAATGCTTTTGGG + Intronic
1029489057 7:100860485-100860507 AGGGTTCACTGACACTTTTTGGG + Intronic
1029839378 7:103345974-103345996 AGGGATCAGGAAGAGGTTTTGGG - Intronic
1032695492 7:134332516-134332538 AGGATTCATGGAAAGGTTCTTGG - Intergenic
1036666713 8:10748978-10749000 AGGCTTTATTGGGAGGTGTTTGG + Intronic
1041525152 8:58797033-58797055 AGACTTCAGAGAGAGGTTTTGGG + Intergenic
1041707005 8:60857203-60857225 AAGTTTCATTGATATGTTTTAGG + Intronic
1043334147 8:79151934-79151956 GGGGTTTAATGAGAGGTGTTTGG + Intergenic
1044759357 8:95501280-95501302 AGGGGTAGTTGAGAGGTTCTTGG + Intergenic
1046779649 8:118201457-118201479 AGTGTTCATTGTGGGTTTTTTGG - Intronic
1047013080 8:120693212-120693234 GGGGTCCAGTGAGAGGTGTTTGG - Intronic
1047370221 8:124250077-124250099 AATGTTCACGGAGAGGTTTTTGG - Intergenic
1051737458 9:20215961-20215983 AGGATTCATTGAGAGGCTATTGG - Intergenic
1054796666 9:69308594-69308616 AGGTTACATTCACAGGTTTTAGG - Intergenic
1054929116 9:70617991-70618013 TGGGTTTTTTGAGAGTTTTTTGG - Intronic
1055211035 9:73791717-73791739 AGGTTTCATTGAGAAGTCTCAGG - Intergenic
1056425550 9:86472234-86472256 AGGGTTCATGAGGGGGTTTTGGG + Intergenic
1056698142 9:88878198-88878220 AGGTTCCATTGAGTGGTGTTTGG - Intergenic
1056817258 9:89811171-89811193 AGGGCTCTTTGAAATGTTTTAGG - Intergenic
1058269538 9:102953136-102953158 AGTGTTCATTGGCAGATTTTTGG + Intergenic
1058784938 9:108377666-108377688 AGGGTTCATTTAGATGGTTGGGG + Intergenic
1059895482 9:118859570-118859592 ATGGTTTATTGAGAGTTTTTAGG - Intergenic
1061648122 9:132023011-132023033 AGGGCTCCTTGAGATGTCTTAGG + Intronic
1061821034 9:133227251-133227273 AAGGTTCAGTGAGGGGCTTTTGG + Intergenic
1062238231 9:135522802-135522824 AAGGTTCAGTGAGGGGCTTTGGG - Intronic
1185831080 X:3303631-3303653 AGGTTCCATTGACAGGTTCTGGG - Intergenic
1187750739 X:22461980-22462002 AGGGTGCATTGAGAGGTAATAGG - Intergenic
1189783545 X:44539332-44539354 AGGTCACATTTAGAGGTTTTGGG - Intronic
1190057271 X:47188252-47188274 AGGGTTCCTTGTGGGATTTTGGG - Intergenic
1190300190 X:49052994-49053016 AGGGTACATGGAGAGGAGTTTGG + Intergenic
1190377573 X:49804703-49804725 AAGGTTAAGTGTGAGGTTTTGGG - Intergenic
1193080320 X:77400116-77400138 AGGATCCACTGAAAGGTTTTGGG - Intergenic
1193837091 X:86356830-86356852 AGGGTACAAGAAGAGGTTTTTGG + Intronic
1194464683 X:94218909-94218931 AGGGTGCTTTTAGAGGATTTGGG + Intergenic
1194677482 X:96811703-96811725 CTAGTTTATTGAGAGGTTTTAGG + Intronic
1195255678 X:103087492-103087514 AGGTTTCATTGTGAAGTTGTTGG - Intronic
1195710607 X:107770681-107770703 AGAGCTGATTAAGAGGTTTTGGG + Intronic
1197701923 X:129605985-129606007 CGGGTTCTTTGGGATGTTTTAGG + Intergenic
1197881488 X:131171364-131171386 AGGATTAAATGAGATGTTTTGGG + Intergenic
1198033012 X:132773509-132773531 AGCATTCATATAGAGGTTTTTGG - Intronic
1198122617 X:133608778-133608800 AGGGTTTATAAATAGGTTTTCGG + Intronic
1199099425 X:143781481-143781503 GGGGTCCTTTGAGAGGTTGTTGG + Intergenic
1201576904 Y:15470565-15470587 AGGCTTCCTGGAGAGCTTTTGGG + Intergenic