ID: 977634380

View in Genome Browser
Species Human (GRCh38)
Location 4:99280197-99280219
Sequence ATTGAGAGGTTTTGGGAATC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 1, 2: 1, 3: 30, 4: 356}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977634372_977634380 15 Left 977634372 4:99280159-99280181 CCTTCCAGGTACGTCCAGTCAGT 0: 1
1: 1
2: 0
3: 0
4: 65
Right 977634380 4:99280197-99280219 ATTGAGAGGTTTTGGGAATCAGG 0: 1
1: 1
2: 1
3: 30
4: 356
977634370_977634380 28 Left 977634370 4:99280146-99280168 CCAAGAATAGCTCCCTTCCAGGT 0: 1
1: 1
2: 0
3: 7
4: 166
Right 977634380 4:99280197-99280219 ATTGAGAGGTTTTGGGAATCAGG 0: 1
1: 1
2: 1
3: 30
4: 356
977634371_977634380 16 Left 977634371 4:99280158-99280180 CCCTTCCAGGTACGTCCAGTCAG 0: 1
1: 1
2: 1
3: 5
4: 72
Right 977634380 4:99280197-99280219 ATTGAGAGGTTTTGGGAATCAGG 0: 1
1: 1
2: 1
3: 30
4: 356
977634373_977634380 11 Left 977634373 4:99280163-99280185 CCAGGTACGTCCAGTCAGTAGCA 0: 1
1: 1
2: 1
3: 1
4: 38
Right 977634380 4:99280197-99280219 ATTGAGAGGTTTTGGGAATCAGG 0: 1
1: 1
2: 1
3: 30
4: 356
977634376_977634380 1 Left 977634376 4:99280173-99280195 CCAGTCAGTAGCAGCATAGGGTT 0: 3
1: 0
2: 0
3: 2
4: 64
Right 977634380 4:99280197-99280219 ATTGAGAGGTTTTGGGAATCAGG 0: 1
1: 1
2: 1
3: 30
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977634380 Original CRISPR ATTGAGAGGTTTTGGGAATC AGG Exonic
901077794 1:6566269-6566291 GCAAAGAGGTTTTGGGAATCAGG + Intronic
901849133 1:12004342-12004364 AGTGAGAGGGTCTGGGAAACTGG - Intronic
902303952 1:15523176-15523198 GTTAAGAGGTTTTGGAAATGAGG - Intronic
902868624 1:19298319-19298341 CTTTTGAGGTTTTGGGACTCAGG + Intergenic
903028510 1:20446227-20446249 AGTGGGTGGTTTTGGGGATCTGG + Intergenic
903128074 1:21261185-21261207 ATTGAGGGGTTTAGAGTATCTGG - Intronic
903623993 1:24718200-24718222 ATTAAGAGGTCTTGGGCAGCAGG + Intergenic
906045652 1:42828958-42828980 GTTGAGGGGTTTTGGGATTAGGG + Intronic
906176191 1:43775185-43775207 ATAGGGAGGTTCTGGCAATCAGG - Intronic
906734366 1:48110311-48110333 AGTGAGAAGTTCTGGGAATGGGG + Intergenic
906744244 1:48210636-48210658 AATGAGAGGTTCTGAGAAGCAGG + Intergenic
906771188 1:48486272-48486294 ATCGACAGGTTCTGGGAATTAGG - Intergenic
906778416 1:48550587-48550609 ATTGATAGGTTCTAGGGATCAGG + Intronic
907944871 1:59126438-59126460 ATTGAGAATTTTGGTGAATCTGG - Intergenic
908684246 1:66697363-66697385 ATTGAGATGTTTAAGGAATTTGG - Intronic
909761308 1:79290874-79290896 ATCCAGAGGTTTTTGCAATCTGG + Intergenic
910275857 1:85448395-85448417 AGTGAGAGGTTCTGAAAATCTGG + Intronic
910354935 1:86342811-86342833 GCAAAGAGGTTTTGGGAATCAGG - Intergenic
910631129 1:89355335-89355357 ATTCAGAGGTTTTGGAGGTCAGG + Intergenic
911852182 1:102833915-102833937 AGTGAGAAGTTTTCTGAATCAGG + Intergenic
911866938 1:103039383-103039405 AATGTGAGGTATTGGGAATTAGG - Intronic
913226034 1:116699198-116699220 TTTGAGAGTTGTTGTGAATCTGG - Intronic
914327148 1:146630251-146630273 ATTCATAGGTTCTGGGAATTAGG + Intergenic
916189081 1:162161243-162161265 ATTCATAGGTTTTGGGGATTAGG + Intronic
916660537 1:166919502-166919524 AATGAAAGGTTCTGAGAATCAGG - Intronic
917930368 1:179818524-179818546 ATGGACAGGTTTTGGGGATGTGG - Intergenic
918355758 1:183705602-183705624 ACAAAGAGGTTTTGGGAATCAGG + Intronic
918609787 1:186475451-186475473 ATTGATAGGTTTTCGGAAACTGG - Intergenic
920368736 1:205463574-205463596 ATTGACAGGTATTGGGAATTAGG + Intergenic
920452583 1:206071089-206071111 CTTATGAGGTTTTGGGACTCCGG - Intronic
920705203 1:208245195-208245217 GGTGAGAGGTTTCGGGATTCTGG + Intergenic
921779315 1:219142684-219142706 TTTGAGAAGTTTTGAGAATCTGG + Intergenic
922042798 1:221913543-221913565 ATTCAGAGGTGATTGGAATCTGG - Intergenic
922390037 1:225131642-225131664 ATTCACAGGTTCTGGGAATTAGG + Intronic
923001048 1:230006666-230006688 ATTAAGAGGTGCTGGGAATTAGG + Intergenic
923987092 1:239393502-239393524 AGGGAGAGGTGATGGGAATCTGG + Intronic
924140010 1:241012499-241012521 AATGAGAGATTTTGGAAATGTGG - Intronic
924161945 1:241241966-241241988 TTTCATAGGTTTTGGGAAACAGG + Intronic
924238895 1:242022492-242022514 ATTGACAAGTTTTGGGGATTAGG + Intergenic
924795497 1:247289544-247289566 GCAAAGAGGTTTTGGGAATCAGG - Intergenic
1063168078 10:3481866-3481888 ATTCTGAGGTTGTGGGGATCAGG + Intergenic
1064624704 10:17250652-17250674 ATAGAGAGGTTTGGGGTCTCTGG + Intergenic
1069617629 10:69816300-69816322 ATTGTGAGGTTTTGAGCAACTGG + Intronic
1070739054 10:78890416-78890438 ATTGATAGGTGTTGGGAAGCTGG + Intergenic
1071096699 10:81983836-81983858 ATTCACAAGTTTTGGGGATCAGG - Intronic
1073058460 10:100717523-100717545 ATTCATAGGTTTTGGGGATTAGG - Intergenic
1073712966 10:106066391-106066413 ATGGACAGGCCTTGGGAATCTGG - Intergenic
1075244937 10:120812577-120812599 ATTGATAGGTTTTGGGGATTAGG + Intergenic
1075283132 10:121158430-121158452 ATTCACAGGTTGTGGGAATTAGG + Intergenic
1075699470 10:124459848-124459870 ATTTAGAGGTTGTGGGGATTGGG + Intergenic
1076386751 10:130062631-130062653 CTTTTGAGGTTTTGGGACTCAGG + Intergenic
1077572947 11:3355055-3355077 GCAAAGAGGTTTTGGGAATCGGG + Intronic
1078472938 11:11606165-11606187 ACTGAGAGGTTTTAGGCAGCTGG + Intronic
1078916383 11:15782574-15782596 ATTCACAGGTTTTAGGGATCAGG - Intergenic
1079801122 11:24870258-24870280 ATTGAGAGGCTTAGGCAATGTGG - Intronic
1079914911 11:26357044-26357066 ATTCACAGGTTTTGGGAGTTAGG + Intronic
1081062601 11:38499152-38499174 CTTTTGAGGTTTTGGGACTCAGG + Intergenic
1081261107 11:40962074-40962096 ATTGACAGGTCTGGGGCATCAGG - Intronic
1083086859 11:60157537-60157559 ATTCAAAGGTTCTGGGGATCAGG + Intergenic
1083983214 11:66191392-66191414 ATTCACAGGTTTTGGGGATTAGG + Intronic
1084988967 11:72905081-72905103 ATTCACAGGTTTTGGGAATTAGG - Intronic
1086458983 11:86986622-86986644 ATGAAAAGGGTTTGGGAATCTGG + Intergenic
1086772835 11:90790822-90790844 AGTGAGAGTTTTGGGGAATAAGG - Intergenic
1086978505 11:93165988-93166010 ATTGGAAGGTTGTGGGGATCTGG + Exonic
1087974930 11:104532933-104532955 ATTCATAGGTTCTGGGAATTAGG + Intergenic
1088077387 11:105867518-105867540 ATAGAGACTTTTTGGGAGTCCGG - Intronic
1088090403 11:106032072-106032094 ATTTACATGTTTTGGGAATTGGG - Intergenic
1088212610 11:107473344-107473366 CTTTTGAGGTTTTGGGACTCTGG - Intergenic
1088581767 11:111323524-111323546 ATAGAAAGCTTTTAGGAATCAGG - Intergenic
1089053327 11:115564799-115564821 ACTGAGAGCTTTTGGGGGTCAGG + Intergenic
1092631351 12:10381149-10381171 AGTGAGTGGCTCTGGGAATCTGG - Intronic
1095197952 12:39344966-39344988 TTTGAGATGTTCTGGGAGTCAGG - Intronic
1095397705 12:41779286-41779308 ATTCACAGGTTCTGGGAATTAGG + Intergenic
1096107565 12:49005769-49005791 ATTTGGAGCTTGTGGGAATCAGG + Exonic
1096713104 12:53472301-53472323 ATTCAGAGCTTGTGGGAATGTGG + Intronic
1096864707 12:54555591-54555613 ATTTAAAGGTTGGGGGAATCTGG - Intronic
1098048721 12:66429897-66429919 ACAGAGAGGTTGAGGGAATCAGG + Intronic
1098668532 12:73195823-73195845 ATTGAGAGTTTTTAGCATTCAGG + Intergenic
1098835280 12:75417067-75417089 ATTGACAGGTTCTGGAAATTAGG - Intronic
1100099111 12:91080780-91080802 ATTCTGAGGTTCTGGGAGTCAGG + Intergenic
1100474279 12:94921496-94921518 ATTCCAAGGTATTGGGAATCTGG + Intronic
1100867424 12:98872192-98872214 ATTCATAGGTATTGGGAATTAGG - Intronic
1101419051 12:104533961-104533983 ATTGAAAGGATTTGGGGATGGGG - Intronic
1101709544 12:107252235-107252257 ATTGAGAGGTTTTGGAGTCCAGG + Intergenic
1101898189 12:108771138-108771160 CCTGAGAAGTTTGGGGAATCAGG - Intergenic
1102518355 12:113464719-113464741 ATTGAGATCTTTTGAGAAGCTGG + Intronic
1102890075 12:116551918-116551940 ATTCTGAGGTGTTGGGAATTTGG + Intergenic
1104170338 12:126274481-126274503 ATTCACAGGTTCTGGGAATTAGG + Intergenic
1105580950 13:21695429-21695451 ATTTAGAGGTTTTGGAAAACAGG + Intronic
1106572117 13:30936062-30936084 ATTCACAGGTTTTGGGGATTAGG + Intronic
1106808086 13:33332129-33332151 AGGGAGAGGTTTAGGGAATGGGG - Intronic
1107055443 13:36098789-36098811 ATTAAGATGTATTGGGAATCAGG - Intronic
1107162573 13:37248865-37248887 CTAGAGAGGTTTTTGGAAGCTGG - Intergenic
1108108480 13:47040759-47040781 TTAGAGAGGTTTTTGGAGTCAGG - Intergenic
1108681516 13:52784755-52784777 ATTCATAGGTTCTGGGAATTAGG + Intergenic
1110865691 13:80393043-80393065 ATTGACAGGTTCTGGGATTTCGG - Intergenic
1113753982 13:112796296-112796318 AGTCAGAGGTTCTGGGGATCAGG - Intronic
1114112532 14:19487262-19487284 AGAGAGAGGCCTTGGGAATCTGG + Intergenic
1114237111 14:20833257-20833279 GCAAAGAGGTTTTGGGAATCAGG + Intergenic
1114976904 14:28113104-28113126 ATTCAGAGATTTTAGGAATTAGG + Intergenic
1116064447 14:39964726-39964748 TTTAATAGGTTTTGGGAAACAGG - Intergenic
1116206893 14:41879435-41879457 TTTGTGAGTATTTGGGAATCCGG - Intronic
1116221485 14:42094310-42094332 CTTTTGAGGTTTTGGGACTCAGG + Intergenic
1117858059 14:60056179-60056201 ATTCACAGGTTTTGGGAATTAGG + Intronic
1118009258 14:61592610-61592632 ATTCACAGGTTTTGGGAGTTAGG + Intronic
1118916012 14:70106803-70106825 ATTGTGAGGATTTGAGAATATGG + Intronic
1118942065 14:70347418-70347440 GCAAAGAGGTTTTGGGAATCAGG - Intronic
1119600458 14:75972575-75972597 ATTGAGAGGATTTGAGGATGGGG + Intronic
1119609629 14:76050732-76050754 AGTGAGAGGTGTTGGGAATTGGG - Intronic
1119689621 14:76661395-76661417 ATTTACAGGTTTTAGAAATCAGG + Intergenic
1120485099 14:85103511-85103533 ACTGAGAGGTTTTAGAATTCTGG - Intergenic
1121168114 14:91827669-91827691 ATTCACAGGTTCTGGGAATTAGG + Intronic
1121771494 14:96546770-96546792 GTTGAGAGTTTTTGGGATTTTGG + Intronic
1121856612 14:97276204-97276226 ATTCACAGGTTTGGGGAATTAGG - Intergenic
1122173797 14:99901172-99901194 ACTGAGGGGTTCTGGGAAGCAGG - Intronic
1122506849 14:102237057-102237079 GCAAAGAGGTTTTGGGAATCAGG - Intronic
1123769066 15:23510657-23510679 AATGAGAGGTTTTGGCCAACGGG + Intergenic
1124513759 15:30349145-30349167 AAAGAGAGGTTTTCAGAATCAGG + Intergenic
1124729162 15:32181620-32181642 AAAGAGAGGTTTTCAGAATCAGG - Intergenic
1125902769 15:43364247-43364269 GCTGAGAGGTTATGGGAATATGG - Exonic
1126304017 15:47234106-47234128 AATGAGATGTTTTGGGAATAAGG + Intronic
1126449419 15:48789510-48789532 ATTCACAGGTTTTGGGGATTAGG - Intronic
1127333840 15:57964459-57964481 ATTGAGAGGATCTGGCAACCTGG - Intronic
1127374092 15:58366860-58366882 ATTGAGAGTTTTTGGGAGAAAGG - Intronic
1128132359 15:65237378-65237400 ATTCACAGGTTCTGGGAATTAGG - Intronic
1130528607 15:84728107-84728129 CTTTTGAGGTTTTGGGACTCAGG - Intergenic
1132018550 15:98340092-98340114 ATTCACAGGTTCTGGGAATTAGG + Intergenic
1133214167 16:4281008-4281030 ATTGATAGGTTCTGGGGATGGGG + Intergenic
1133431612 16:5742074-5742096 AATGAGAGGTTTTCTGATTCTGG + Intergenic
1133567238 16:7007501-7007523 ATTGACAGGTTCTGGGGATTAGG + Intronic
1134085936 16:11357498-11357520 ATTCAGAGGTTCTGGGGATTAGG + Intergenic
1134214403 16:12305715-12305737 ATTCAGAAGTTTTCGGAGTCTGG - Intronic
1137565009 16:49527329-49527351 ATTGACAAGTTTTGGGACACAGG + Intronic
1137733825 16:50709750-50709772 ATTCACAGGTTCTGAGAATCCGG + Intronic
1138218930 16:55233378-55233400 ATTGATAGGTTCTTGGAAACTGG - Intergenic
1138789884 16:59890874-59890896 TTTTTGAGGTTTTGGGACTCAGG + Intergenic
1139047997 16:63086746-63086768 CTGGAGGTGTTTTGGGAATCGGG - Intergenic
1140006412 16:71080688-71080710 ATTCATAGGTTCTGGGAATTAGG - Intronic
1140303018 16:73776310-73776332 ATGGAGAGGTTGTGGGAAGGTGG - Intergenic
1141277008 16:82597467-82597489 ATTCACAGGTTTTGGGGATTAGG - Intergenic
1143112908 17:4562779-4562801 AATGAGAGGTTCTGGGAACTAGG - Intergenic
1143267835 17:5653696-5653718 ATTCAGAGGTTCTGGGGATTAGG - Intergenic
1143734807 17:8904039-8904061 ATTGAGGGGTTTTGAATATCAGG + Intronic
1143763624 17:9122423-9122445 AATGAGAGGCTTTGGGATTGGGG + Intronic
1144198339 17:12917036-12917058 ATTGGGAGTTTTTGGGATTTTGG - Intronic
1145732944 17:27206332-27206354 ATTCACAGGTTCTGGGAATTAGG + Intergenic
1145803917 17:27712894-27712916 AAGGAGAGGTTTTTAGAATCAGG - Intergenic
1146718361 17:35105109-35105131 ATTGAGAGGTTTGGGCTATAAGG + Intronic
1147562551 17:41518099-41518121 AGAGAGGGGTCTTGGGAATCTGG - Intronic
1149053178 17:52331037-52331059 ATTGAGAGGTTTTCTGACTTCGG + Intergenic
1150146648 17:62774715-62774737 ACTGACAAGATTTGGGAATCTGG - Intronic
1150417014 17:64995981-64996003 ATTCACAGGTTCTGGGGATCAGG - Intergenic
1150794655 17:68227943-68227965 ATTCACAGGTTCTGGGGATCAGG + Intergenic
1151035799 17:70797599-70797621 ATTCACAGGTTCTGGGAATTTGG + Intergenic
1151249279 17:72821095-72821117 AATGTGAGGTTTTTGGAAACTGG + Intronic
1155341054 18:24814513-24814535 ATTGACAGGTTCTGGGTATTAGG + Intergenic
1155663329 18:28277899-28277921 ATTGAGCAGTTTGGGGAAGCTGG - Intergenic
1155927622 18:31673757-31673779 ATTCACAGGTTCTGGGAATTAGG - Intronic
1158566764 18:58560661-58560683 ATTCACAGGTTCTGAGAATCAGG + Intronic
1158839441 18:61368241-61368263 ATTCACAGGTTCTGGGAATAAGG + Intronic
1159103235 18:63978149-63978171 AGTCACAGGTTTTGGGAATTAGG + Intronic
1159704403 18:71668681-71668703 CTTTTGAGGTTTTGGGACTCGGG - Intergenic
1159898801 18:74022733-74022755 ATTGTGAGGTTCTGGGACTTAGG - Intergenic
1160336008 18:78040219-78040241 ATTTACAGGTTCTGGGAATTAGG + Intergenic
1161879765 19:6940393-6940415 ATTGAGAGGTTCTCTGTATCAGG - Exonic
1162552495 19:11365374-11365396 CTTCAGAGGTTTTGGGGTTCAGG + Exonic
1163907693 19:20161363-20161385 ATTGAGTGGTTCAGGGAAACTGG + Intergenic
1164111966 19:22172389-22172411 CTTGAGAAGTTTTGTGCATCCGG + Intergenic
1164196453 19:22968172-22968194 ATTGGGAAGTTTTGTGTATCTGG + Intergenic
1164393254 19:27843636-27843658 GCAAAGAGGTTTTGGGAATCAGG + Intergenic
1165935827 19:39388509-39388531 ATTGGGAAGTTTTGGGGATTGGG - Intronic
1165995950 19:39844347-39844369 ATTGAGATGTTTTGAGTATCTGG - Intronic
1167793696 19:51695608-51695630 ATGGAGAGGTTTAGGGCCTCAGG - Intergenic
925890648 2:8431412-8431434 ATTTACAGGTTCTGGGAATTGGG - Intergenic
927059415 2:19401459-19401481 ATTTACAGGTTATGGGAATTAGG + Intergenic
928705976 2:33950214-33950236 AATGAGAGAGATTGGGAATCTGG - Intergenic
929414475 2:41733334-41733356 TTTGAGGGGCTTTGGGATTCTGG + Intergenic
930072667 2:47380586-47380608 ATTGAGTGGTTTGGGGGTTCAGG - Intronic
931049997 2:58402028-58402050 ACTCAGAGGTCTTGGGAATTAGG + Intergenic
931186769 2:59960088-59960110 GTTGAGAAGATTTGGGAAACAGG - Intergenic
932336579 2:70935157-70935179 ATTGAGAGTTCTTGAGAATGAGG - Intergenic
932376086 2:71237185-71237207 ATTCATAGGTTCTGGGGATCAGG + Intergenic
935557477 2:104526181-104526203 AATGAGAAGCTTTGGGAATGGGG - Intergenic
936428551 2:112438529-112438551 ATTCACAGGTTTTGGGGATTAGG + Intergenic
937286092 2:120752688-120752710 CTTGAGAGGTTTTGGGTGGCTGG - Intronic
937751659 2:125482642-125482664 TTCAATAGGTTTTGGGAATCAGG + Intergenic
940180347 2:150924824-150924846 ATTGAGAGTTTATGTGAATTTGG + Intergenic
941755264 2:169178686-169178708 ACTGAGAGGACTTGGGAATTTGG - Intronic
941822950 2:169860866-169860888 CTTTCGAGGTTTTGGGACTCGGG - Intronic
941957579 2:171220197-171220219 ATTTACAGGTTCTGGGAATTAGG + Intronic
942579463 2:177401850-177401872 ATTGAGATGTTTTAAAAATCTGG - Intronic
942904497 2:181165011-181165033 ATTGAGAGGGTTTGGGCATAGGG + Intergenic
943549157 2:189317603-189317625 ATTGAGTGGTTTTGTAAATTTGG - Intergenic
943667877 2:190629205-190629227 ATTGAAAGCTCATGGGAATCGGG - Intergenic
943918254 2:193666295-193666317 ATTAACAGGTTTTGGGAAATAGG + Intergenic
944148309 2:196530164-196530186 AGTGGGAGGTTTTGGGGAACTGG - Intronic
944312038 2:198244326-198244348 ATTCACAGGTTCTGGGGATCAGG - Intronic
945394566 2:209303255-209303277 AATGAGAGGTTCTGGGAGGCGGG - Intergenic
945564914 2:211385555-211385577 ATTAAGAAGTTTAAGGAATCTGG - Intronic
945594047 2:211769605-211769627 CTTTTGAGGTTTTGGGACTCAGG - Intronic
946787690 2:223265060-223265082 ATTCAGAGGTTCTGGGGATTAGG + Intergenic
947364246 2:229377865-229377887 ATTGATAGGTTCTGGGCATTAGG - Intronic
1169133398 20:3180201-3180223 ATTCACAGGTTCTGGGAATTAGG - Intergenic
1169401946 20:5289523-5289545 ATTGACAGGTTCTGGGGATTAGG + Intergenic
1170288752 20:14743734-14743756 ATTCACAGGTTCTGGGAATTAGG - Intronic
1172318844 20:33980212-33980234 CTTCAGAGGTTTGGGGAATCAGG - Intergenic
1174132510 20:48355877-48355899 ATTCAGAGGGTTGGGGCATCAGG - Intergenic
1174703853 20:52636079-52636101 ACTCACAGGTTTTGAGAATCAGG - Intergenic
1174839883 20:53891813-53891835 AGTCATAGGTTTTGGGAATTAGG + Intergenic
1175030507 20:55949057-55949079 ATTGAGAGGTTATAAGATTCAGG + Intergenic
1175377408 20:58538220-58538242 TTTGAGAGGTTCTGGTACTCAGG + Intergenic
1175938779 20:62527584-62527606 ATTGATAGGTTTTTGGAAACTGG + Intergenic
1176113459 20:63421128-63421150 CTTGGGAGGTTTGGGGAAGCGGG - Intronic
1176995507 21:15550829-15550851 ATTCACAAGTTCTGGGAATCAGG + Intergenic
1177395925 21:20536310-20536332 CTTTTGAGGTTTTGGGACTCGGG - Intergenic
1178258592 21:31077923-31077945 ATTTAAAGGTTTTGGGAATTAGG - Intergenic
1181554552 22:23661023-23661045 ATCCACAGGTTTTGGGAATTAGG - Intergenic
1181645155 22:24226863-24226885 ATCCACAGGTTTTGGGAATTAGG - Intronic
1184278401 22:43423508-43423530 AGGGATATGTTTTGGGAATCAGG + Intronic
1184874075 22:47261650-47261672 ATTCACAGGTTTTGGGGATTAGG + Intergenic
949176670 3:1071975-1071997 ATTGACAGGTTCTGAAAATCAGG - Intergenic
949411759 3:3773273-3773295 ATTCTGAGGTTTTGGGAGTTAGG + Intronic
951336320 3:21426731-21426753 ATTTAGTGGTTCTGGGAAGCTGG - Intronic
952460603 3:33521681-33521703 ATTGAGAGATTCTGGGAAGATGG + Intronic
952475682 3:33707926-33707948 ATTCAGAGGTTCTGGGAGTCAGG - Intronic
955136166 3:56220485-56220507 ATTGAGAGGGATGGAGAATCAGG + Intronic
955539304 3:59957128-59957150 ATTGAGAGGTACTGGGGATGAGG - Intronic
955896597 3:63707107-63707129 ATTCCCAGGTTTTGGGGATCAGG + Intergenic
956733002 3:72214004-72214026 ATTCACAGGTTTTGGGGATTAGG + Intergenic
958103653 3:89046453-89046475 ATTTACAGGTTCTGGGAATTGGG + Intergenic
959351606 3:105272042-105272064 ATTAATAGGTTTTGAGATTCAGG - Intergenic
960001034 3:112732128-112732150 ATTAATAGGTTTTGGGAATTAGG + Intergenic
960140592 3:114148594-114148616 ATTGAGAGGTTTGGGGAGTTGGG - Intronic
962890031 3:139663404-139663426 ATTCACAGGTTCTGGGAATTAGG + Intronic
963456393 3:145552847-145552869 AATGAGAGGTTTTGAGAGGCAGG + Intergenic
963905059 3:150766551-150766573 ATTGTGTGGTTTTGCAAATCAGG + Intergenic
964047564 3:152348571-152348593 TTACAGAGCTTTTGGGAATCAGG + Intronic
964109265 3:153072453-153072475 TTTGAGAGTTTTTTGGAAGCAGG - Intergenic
964143793 3:153434129-153434151 ATTCACAGGTTCTGGGAATTAGG + Intergenic
964283203 3:155089671-155089693 ATTCAGAGGCTCTGGGAATTGGG - Intronic
965348040 3:167576455-167576477 ATTCACAGGTTCTGGGAATTAGG - Intronic
965872503 3:173278649-173278671 GCAAAGAGGTTTTGGGAATCAGG - Intergenic
966449391 3:180040777-180040799 GATAAGAGGTTTAGGGAATCTGG - Intergenic
966809189 3:183828150-183828172 ATTGAGGGGTTTTAGGGACCAGG + Intergenic
966990457 3:185224965-185224987 ATTCACAGGTTCTGGGAATTAGG + Intronic
970008992 4:11437961-11437983 ATTCATAGGTTCTGGGGATCCGG - Intergenic
970629103 4:17922027-17922049 CTTTTGAGGTTTTGGGACTCAGG + Intronic
970734298 4:19148161-19148183 ATTCACAGGTTTTGGGGGTCAGG + Intergenic
970906525 4:21223021-21223043 ATTTAGAGGCTCTGGGAATTAGG - Intronic
971264254 4:25084243-25084265 ATTCATAAGTTTTGGGAATTAGG - Intergenic
971513411 4:27456250-27456272 ATTGGGAGGTTCTGGGAACTGGG - Intergenic
971778446 4:30998727-30998749 ATTGATAGGATTTGGGGATAAGG + Intronic
974275492 4:59715478-59715500 ATGGAGAGGTTTTGTGAAATTGG - Intergenic
974958930 4:68675181-68675203 GCAAAGAGGTTTTGGGAATCAGG - Intergenic
975196196 4:71527079-71527101 ATTCACAGGTTGTGGGAATTAGG + Intronic
976299872 4:83507392-83507414 GCAAAGAGGTTTTGGGAATCAGG + Intronic
976863812 4:89699995-89700017 TTTGAGAGGTTGTATGAATCAGG - Intergenic
977026374 4:91823456-91823478 CTTTTGAGGTTTTGGGACTCGGG - Intergenic
977429094 4:96908953-96908975 ATTTAGAAGTTCTGGGAATTGGG + Intergenic
977464632 4:97368278-97368300 ATTCACAGGTTCTGGGAATCAGG + Intronic
977634380 4:99280197-99280219 ATTGAGAGGTTTTGGGAATCAGG + Exonic
977637058 4:99311574-99311596 ATTGAGAGGTTCTGGGAAGCAGG + Exonic
977639503 4:99340628-99340650 ATTGAGAGGTTCTGGGAATCAGG + Exonic
977657907 4:99543983-99544005 ATTCAAAGGTTCTGGGAATTAGG + Intergenic
978330366 4:107606098-107606120 ATTAACAGGTATTGGGAATATGG - Intronic
978352363 4:107833381-107833403 ATTCATAGGTTCTGGGAATTAGG - Intronic
979418028 4:120467317-120467339 ATTGAGAGGTTTTGGAGTCCAGG - Intergenic
979714724 4:123823670-123823692 ATTCAGAAGTTCTGGGAATTAGG + Intergenic
980679459 4:136138613-136138635 ATAAAGATGTTCTGGGAATCTGG + Intergenic
981922625 4:150102115-150102137 AATAGGAGGTTTGGGGAATCAGG + Intronic
982086627 4:151842414-151842436 ATTGAGTGGATTTGAGAAACTGG - Intergenic
982280881 4:153683062-153683084 ATTGAGAGGTTTTTGTATACAGG - Intergenic
982587800 4:157264604-157264626 ATTCACAGGTTTTGGGAATTAGG + Intronic
983610972 4:169644701-169644723 ATTTACAGGTTTTGGGAATTCGG - Intronic
984067730 4:175069913-175069935 ATTCACAGGTTTTGGGGATTAGG - Intergenic
985205182 4:187528189-187528211 ATAGAGGGGATTTTGGAATCTGG + Intergenic
986926034 5:12753431-12753453 CTTTTGAGGTTTTGGGACTCTGG - Intergenic
987521698 5:18993992-18994014 ATTGTGAGGAGTTAGGAATCCGG + Intergenic
987562117 5:19538016-19538038 ATTGATAGGTTTTGGTTATTAGG + Intronic
988488916 5:31690803-31690825 ATTCACAGGTTCTGGGAATTAGG + Intronic
990185251 5:53204097-53204119 GCAAAGAGGTTTTGGGAATCAGG - Intergenic
990335146 5:54765001-54765023 ATTCTGAGGTATTGGGGATCAGG + Intergenic
991064307 5:62409637-62409659 ATTCACAGGTTTTGGGGATTAGG + Intronic
992754582 5:79892339-79892361 ATTCACAGGTTCTGGGGATCAGG - Intergenic
992815307 5:80431390-80431412 ATTGAGAGGTTTTGGCATGAAGG - Intronic
992963097 5:81974822-81974844 ATTGAGGGATATTGAGAATCTGG - Intronic
993129583 5:83878609-83878631 ATCGACAGGATTTGGGAAGCTGG - Intergenic
993221265 5:85100447-85100469 ATTAAATGGTTTTGGGAAACTGG - Intergenic
993743855 5:91571675-91571697 CTTAAGAGGTTTTTGGAATTTGG + Intergenic
995191256 5:109321093-109321115 ATTTAGAGGTGATGGGAATCAGG - Intergenic
995404971 5:111784768-111784790 TTTGAGAGATTTTAGGAATATGG + Intronic
995834137 5:116383694-116383716 AATGAGTGGGTTTGGGAAACTGG - Intronic
996152150 5:120052298-120052320 ATTTTGAGGTTATGGGAATTTGG + Intergenic
996177430 5:120377263-120377285 ATTCTGAGGTTCTGGGAATTAGG + Intergenic
996214551 5:120850798-120850820 AGAGAGAGGCTTTGGGAAGCAGG + Intergenic
996252121 5:121348219-121348241 ATTCACAGGTTTGGGGAATCTGG + Intergenic
996449333 5:123601437-123601459 ACTGAGAGGATTGGGGAATCTGG + Intronic
996510169 5:124307844-124307866 AATGAGAGGTTTTGAGAGGCAGG - Intergenic
996919822 5:128754807-128754829 ATTGAGAGGTCTTGGAATTAAGG + Intronic
997670414 5:135666733-135666755 ATTGAGAGTTGTAAGGAATCTGG + Intergenic
998099569 5:139421148-139421170 ATAGAGAGGTTTTTGCCATCAGG - Intronic
998202011 5:140132440-140132462 ACAGTGAGGTTTTGAGAATCTGG - Intergenic
998815289 5:146007644-146007666 ATGGAGAAGTTTTGGGAAATGGG - Intronic
1000887960 5:166769248-166769270 ATGGAGAGATTTGGGGATTCTGG + Intergenic
1006757611 6:36430330-36430352 ATTCACAGGTTCTGGGAATTAGG - Intronic
1008095896 6:47338882-47338904 ATTCAAAGGTTCTGGGAATTGGG + Intergenic
1008818838 6:55606710-55606732 ATTCACAGGTTTTGGGGATTTGG - Intergenic
1009025591 6:57996580-57996602 ATTGTGAGTTTTTTGGGATCTGG + Intergenic
1010736123 6:79445208-79445230 ATTCACAGGTTCTGGGAATTAGG - Intergenic
1011328035 6:86172566-86172588 CTTTTGAGGTTTTGGGACTCAGG + Intergenic
1011566008 6:88672682-88672704 TTTAATAGGTTTTGGGAAACAGG - Intronic
1013055359 6:106577614-106577636 ATTCACACATTTTGGGAATCAGG - Intronic
1014076440 6:117240831-117240853 ATGGAGAAGTTTTGGTGATCTGG + Intergenic
1015095092 6:129406868-129406890 CTTTTGAGGTTTTGGGACTCGGG - Intronic
1016292474 6:142539920-142539942 GCAAAGAGGTTTTGGGAATCAGG - Intergenic
1018339031 6:162830174-162830196 CTTGAGCAGTTTGGGGAATCGGG + Intronic
1021412354 7:20342711-20342733 AGTGAAAGGTGGTGGGAATCTGG + Intronic
1021569032 7:22045710-22045732 CTTTTGAGGTTTTGGGACTCTGG + Intergenic
1021621174 7:22552419-22552441 ATTCTGAGGTATTGGGAATTTGG + Intronic
1022067901 7:26879669-26879691 ATTCACAGGTTCTGGGAATTTGG - Intronic
1023067740 7:36395557-36395579 ATTCAGAGGTTTAGGGTATTAGG + Intronic
1023479258 7:40615361-40615383 ATTGAGAGGTTCTGGAAAAATGG - Intronic
1023967877 7:44972571-44972593 AGTGGGAGGTTTTGGGACCCGGG - Intronic
1025974433 7:66358653-66358675 ATTGACAGGTTCTAGGATTCAGG + Intronic
1027773469 7:82435527-82435549 GTTGTGAGATTTGGGGAATCAGG - Intronic
1027805069 7:82808958-82808980 ATGGAGAGGTTTTGATAAGCTGG + Intronic
1027807889 7:82852590-82852612 CTTTTGAGGTTTTGGGATTCGGG + Intronic
1029053200 7:97711459-97711481 ATTGAGAGTTTTTAGCAATAAGG - Intergenic
1029203931 7:98857320-98857342 ATTGAGATGTTGGGGGAACCTGG - Intronic
1029803947 7:102976991-102977013 GCAAAGAGGTTTTGGGAATCAGG - Intronic
1030382670 7:108830408-108830430 TTTGAGGCATTTTGGGAATCAGG - Intergenic
1032330474 7:130974723-130974745 ACTGAAAGGTTTTGTGGATCAGG + Intergenic
1032728887 7:134618049-134618071 ATTCACAGGTTCTGGGAATTAGG - Intergenic
1034145524 7:148867858-148867880 CTTGAGATGTTTAGGGTATCTGG - Intronic
1034877069 7:154733816-154733838 TTAGAGAGTTTATGGGAATCTGG - Intronic
1037666718 8:20976069-20976091 GTCAAGAGGTTTTGGGAATTTGG - Intergenic
1037683095 8:21115101-21115123 GATCAGAGGTTTTGAGAATCTGG - Intergenic
1038966636 8:32580268-32580290 ATTCACAGGTTCTGGGGATCAGG + Intronic
1039985527 8:42444585-42444607 CATGTGAGGTTTTGGGAATCGGG + Intronic
1040094160 8:43427660-43427682 ATTGAGAGGTTTTTAGCATGAGG - Intergenic
1040499700 8:47995852-47995874 GCAAAGAGGTTTTGGGAATCAGG + Intergenic
1040521583 8:48180801-48180823 ATTCACGGGTTCTGGGAATCAGG + Intergenic
1041669199 8:60475982-60476004 ATTGATTGGTTTTGGGAAAGAGG - Intergenic
1041822608 8:62054840-62054862 AGTGTGAGGTTTTGTTAATCTGG - Intergenic
1042158195 8:65866607-65866629 GCAAAGAGGTTTTGGGAATCAGG - Intergenic
1042748571 8:72133862-72133884 GCAAAGAGGTTTTGGGAATCAGG + Intergenic
1043397321 8:79851717-79851739 ATTGAGAGGCAATGGGTATCCGG + Intergenic
1044057467 8:87588935-87588957 ATTCACAGGTTCTGGGAATTAGG + Intronic
1044895726 8:96889625-96889647 CTTTTGAGGTTTTGGGACTCGGG - Intronic
1045593782 8:103629211-103629233 ATTGAGAGGATATGGTATTCTGG - Intronic
1047063492 8:121253702-121253724 ATGGAGAGGTTCTAGGGATCAGG + Intergenic
1047232222 8:123007340-123007362 ATTCATAGGTTCTGGGAATTAGG + Intergenic
1048085587 8:131174917-131174939 TTTGACAGGTTTAGTGAATCTGG + Intergenic
1048763940 8:137826265-137826287 AATGAGAGGTTCTGGGAGGCGGG + Intergenic
1048854326 8:138673633-138673655 TTTCAGAGGTTGTGGGAAGCGGG + Intronic
1052994345 9:34542498-34542520 ATTCACAGGTTCTGGGAATTAGG + Intergenic
1054930060 9:70626839-70626861 ATTTGAAGGTTTTGGGATTCAGG + Intronic
1055412380 9:76044647-76044669 ATTTAGAGATTTTGGTCATCAGG + Intronic
1055827907 9:80348908-80348930 ATTCACAAGTTCTGGGAATCAGG - Intergenic
1055865535 9:80808883-80808905 CTTTTGAGGTTTTGGGACTCAGG + Intergenic
1055889837 9:81111695-81111717 ATTCACAGGTTTGGGGAATTAGG + Intergenic
1055947463 9:81704347-81704369 AGTGAGAGGTTAATGGAATCAGG + Intergenic
1056913548 9:90725378-90725400 AGTGAGAGGATTTGGGGCTCTGG + Intergenic
1057811187 9:98257820-98257842 ATTAAGAGGTTTTAAAAATCAGG - Intergenic
1058075277 9:100644427-100644449 ATTTACATGTTTTGGGGATCAGG + Intergenic
1058562610 9:106245848-106245870 ATTCACAGGTTCTGGGAATTAGG + Intergenic
1059367417 9:113797289-113797311 GTTGAGAGTTTTGGGGAAACTGG + Intergenic
1061032645 9:128095332-128095354 CTTGACAGGCTTTGGGAATTGGG + Intronic
1061460998 9:130738748-130738770 ATTGATAGGTTCTTGGAAACTGG - Intronic
1185548511 X:965499-965521 ATTCACAGGTTCTGGGGATCAGG + Intergenic
1186167688 X:6844313-6844335 ATTCACAGGTTTTGGCAATTTGG + Intergenic
1186197067 X:7120183-7120205 ATTCACAGGTTCTGGGAATTAGG - Intronic
1186319966 X:8413577-8413599 AAGGTGAGGTTTTGGGAAGCTGG - Intergenic
1187034314 X:15521843-15521865 ATTCACAGGTTCTGGGAATTAGG + Intronic
1187301347 X:18053500-18053522 ATTCACAGGTTCTGGGGATCAGG - Intergenic
1188258849 X:27998589-27998611 AAGGAAAGGTTATGGGAATCTGG + Intergenic
1188740637 X:33775299-33775321 ATTGAGAGGTTTTTGTCTTCTGG + Intergenic
1192922105 X:75717840-75717862 ATTGAGAGTTTTTAGGATTGGGG + Intergenic
1194677483 X:96811710-96811732 ATTGAGAGGTTTTAGGATGAAGG + Intronic
1194754902 X:97727413-97727435 ATTCACAGGCTTTGGGAATCAGG - Intergenic
1194828003 X:98586200-98586222 ATTGAAAGTTTTTGGGCATTAGG + Intergenic
1196465643 X:115969148-115969170 AAGGGGAGGTGTTGGGAATCCGG + Intergenic
1197557782 X:127977065-127977087 ATTCATAGGTTCTGGGAATTAGG - Intergenic
1197574539 X:128194279-128194301 ATTCTGAGGTTTTGGGAGTTGGG + Intergenic
1198328600 X:135599711-135599733 ATTGAGGAGTTTTGGGAATATGG - Intergenic
1198337858 X:135685344-135685366 ATTGAGGAGTTTTGGGACTGTGG + Intergenic
1198361232 X:135897349-135897371 ATTGAGGAGTTTTGGGAATGTGG - Intronic
1199276528 X:145950348-145950370 ATTAAAAGGTTTTGAGAATTTGG + Intergenic
1199278989 X:145977453-145977475 AGTGAGTGGTTTGGGGAGTCAGG - Intergenic