ID: 977634381

View in Genome Browser
Species Human (GRCh38)
Location 4:99280200-99280222
Sequence GAGAGGTTTTGGGAATCAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 1, 2: 4, 3: 21, 4: 293}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977634373_977634381 14 Left 977634373 4:99280163-99280185 CCAGGTACGTCCAGTCAGTAGCA 0: 1
1: 1
2: 1
3: 1
4: 38
Right 977634381 4:99280200-99280222 GAGAGGTTTTGGGAATCAGGAGG 0: 1
1: 1
2: 4
3: 21
4: 293
977634376_977634381 4 Left 977634376 4:99280173-99280195 CCAGTCAGTAGCAGCATAGGGTT 0: 3
1: 0
2: 0
3: 2
4: 64
Right 977634381 4:99280200-99280222 GAGAGGTTTTGGGAATCAGGAGG 0: 1
1: 1
2: 4
3: 21
4: 293
977634372_977634381 18 Left 977634372 4:99280159-99280181 CCTTCCAGGTACGTCCAGTCAGT 0: 1
1: 1
2: 0
3: 0
4: 65
Right 977634381 4:99280200-99280222 GAGAGGTTTTGGGAATCAGGAGG 0: 1
1: 1
2: 4
3: 21
4: 293
977634371_977634381 19 Left 977634371 4:99280158-99280180 CCCTTCCAGGTACGTCCAGTCAG 0: 1
1: 1
2: 1
3: 5
4: 72
Right 977634381 4:99280200-99280222 GAGAGGTTTTGGGAATCAGGAGG 0: 1
1: 1
2: 4
3: 21
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977634381 Original CRISPR GAGAGGTTTTGGGAATCAGG AGG Exonic
903344672 1:22676839-22676861 GAGAGGTGCTGGGAGTCGGGGGG - Intergenic
904051217 1:27640151-27640173 GAGAGGATTTAGAATTCAGGTGG - Intergenic
905138684 1:35822586-35822608 GAGAGGATTTTGGAAAGAGGAGG + Intronic
908008743 1:59754271-59754293 GAGAGGTTTTCAGAGGCAGGGGG - Intronic
909539604 1:76776430-76776452 TGGAGGCTTTGGGAATGAGGAGG - Intergenic
910270820 1:85392011-85392033 AATAGGTTTTGGGGAACAGGTGG + Intronic
911573222 1:99542870-99542892 CAGAGGGGTTGGGAATAAGGAGG + Intergenic
911805703 1:102205342-102205364 AATAGGTTTTGGGGAACAGGTGG + Intergenic
911962363 1:104321549-104321571 AATAGGTTTTGAGAAACAGGTGG - Intergenic
912185367 1:107268746-107268768 GAATGGTTTTGGGAAGGAGGTGG - Intronic
914215267 1:145620926-145620948 GAAAGATTTTGGGAAGCAGTGGG - Intronic
915786444 1:158618198-158618220 GAGAGGCCTTGGGAACCAGTGGG - Intronic
918096934 1:181343759-181343781 GAGAGGTCATGGGAACCATGGGG - Intergenic
918304176 1:183230803-183230825 GATAGGTCTTAGGAATCATGTGG - Intronic
920202188 1:204266399-204266421 GAGAGTCTTTGGGAAGCAGTGGG - Intronic
920616568 1:207498155-207498177 GAGACGTTTTGAAAATCAGATGG + Intronic
921586571 1:216953370-216953392 GAAAGGCTTTGGAAAACAGGGGG - Intronic
923750376 1:236741359-236741381 GAGAGGTATTGGCATTTAGGTGG - Intronic
923825383 1:237494216-237494238 TTGAGGTTTTGGGACTCAGACGG - Intronic
924142296 1:241038091-241038113 AATAGTTTTTGGGAAGCAGGTGG - Intronic
924161946 1:241241969-241241991 CATAGGTTTTGGGAAACAGGTGG + Intronic
1063387656 10:5626174-5626196 GAGAGGTTCTGGAAATCTGCTGG + Intergenic
1064839491 10:19574767-19574789 GAGAGGATTAGGGAAACAGAAGG + Intronic
1065831978 10:29622784-29622806 GAGTGGTTTGGGGAACTAGGGGG - Intronic
1065989786 10:30997251-30997273 CAAAGGATTTGGGAATCAGGTGG + Intronic
1067394601 10:45902980-45903002 GACAGCTTTTGGGAATGAGGAGG + Intergenic
1067862924 10:49872111-49872133 GACAGCTTTTGGGAATGAGGAGG + Intronic
1071297471 10:84232628-84232650 CAGCGGGTTTGGGAATCTGGGGG + Exonic
1072170315 10:92853050-92853072 GCAAGGTTGTAGGAATCAGGTGG + Intronic
1073330087 10:102664604-102664626 GACAGACTTTGGGATTCAGGTGG - Intergenic
1074257074 10:111813449-111813471 CACAGGTTTTGGGGAACAGGTGG + Intergenic
1076415932 10:130288573-130288595 GAGATGTTTTGGGAATTCTGAGG + Intergenic
1079488369 11:20959786-20959808 CATAGGTTTTGGGGAACAGGTGG - Intronic
1081481344 11:43492440-43492462 GAGAGGTTTTCTGGAACAGGTGG - Intronic
1082085334 11:48045247-48045269 GACAGGTTTTGGGAACCACCTGG + Intronic
1082943296 11:58731302-58731324 GAGAGCTTCTTGGAAGCAGGTGG - Intronic
1085138534 11:74118026-74118048 CATAGGTTTTGGGGAACAGGTGG - Intronic
1085402419 11:76242790-76242812 GGGAGGGTTTGGAAAGCAGGAGG - Intergenic
1085449393 11:76622871-76622893 GGGAGGCCTTGGGAAGCAGGTGG - Intergenic
1085503840 11:77044442-77044464 GAGAGGTTGAAGGAAGCAGGAGG + Intergenic
1087054553 11:93920932-93920954 GAGTTGTTTTGGGGATCAGTTGG + Intergenic
1087162376 11:94961309-94961331 GAGAGGTCTTTGAAACCAGGAGG - Intergenic
1087395736 11:97595376-97595398 AATAGTTTTTGGGAAACAGGTGG - Intergenic
1088077384 11:105867515-105867537 GAGACTTTTTGGGAGTCCGGGGG - Intronic
1089077172 11:115747509-115747531 GTAGGGTTTTGGGAAACAGGTGG + Intergenic
1090174666 11:124637926-124637948 GAGTGACTTTGGGAATCATGAGG - Intronic
1091111116 11:132969015-132969037 CATAGGTTTTTGGAAACAGGTGG + Intronic
1091269156 11:134293443-134293465 GAGGGGTGGTGGGAATCAGAGGG + Intronic
1092047574 12:5442995-5443017 CAGAGGTTTTGGGAGTTTGGAGG + Intronic
1092607339 12:10134944-10134966 AACAGGTTTTGGGGAGCAGGTGG - Intergenic
1092631348 12:10381146-10381168 GAGTGGCTCTGGGAATCTGGGGG - Intronic
1094166489 12:27448830-27448852 GAGGGGTTTAGAGAATCATGTGG - Intergenic
1095672295 12:44875925-44875947 AAGAGGTTCTTGGAATCAAGCGG + Intronic
1096694086 12:53337818-53337840 GGAAGGGTTTGGGAACCAGGTGG + Intronic
1096774553 12:53956019-53956041 GAGAGGTTTGGGAAAAAAGGAGG + Intronic
1096982630 12:55737220-55737242 GGGAGCTGTTGGGAAGCAGGGGG - Intergenic
1097102202 12:56597764-56597786 AAGAGGGTTTGGGAAGGAGGTGG + Exonic
1097225972 12:57476970-57476992 GAGAGGATTGGAGAAACAGGTGG + Intronic
1098755754 12:74361360-74361382 AATAGTTTTTGGGAAACAGGTGG + Intergenic
1100717960 12:97325459-97325481 GAGATGTTGTGGGCATCTGGTGG + Intergenic
1101061287 12:100975182-100975204 AATAGTTTTTGGGAAACAGGTGG + Intronic
1101790269 12:107919569-107919591 GGGAGCTTTTGGGCAGCAGGGGG + Intergenic
1103087330 12:118071635-118071657 GAGAGTTTGTGGGGATCAGATGG + Intronic
1103251633 12:119505027-119505049 GAGAGGTTTCAGGAAGGAGGGGG - Intronic
1104943409 12:132405190-132405212 GGGAGGTCCTGGGAAGCAGGCGG + Intergenic
1105806742 13:23955849-23955871 AAGAGGTTTTGGGTAGCTGGAGG + Intergenic
1106337651 13:28798410-28798432 CAGGGGTTTTTGGAGTCAGGTGG - Intergenic
1110483974 13:76016545-76016567 TAGAGGTTGTGGGAAACAGATGG - Intergenic
1112229735 13:97576842-97576864 GAGAGGTTTGGGGAAACAGAGGG - Intergenic
1112266596 13:97929751-97929773 GTGAGGTTTTGGGTTCCAGGAGG + Intergenic
1113149968 13:107252341-107252363 GACAGGTGGTGGGAAACAGGAGG + Intronic
1113451210 13:110411184-110411206 GGGAGTTGTGGGGAATCAGGAGG - Intronic
1113718578 13:112533830-112533852 CATAGGTTTTGGGAAACAAGTGG + Intronic
1114341424 14:21749249-21749271 GAGAGCTTTTGGGGAACAGAGGG + Intergenic
1114514707 14:23291005-23291027 AATAGGTTTTGGGGAACAGGTGG - Intronic
1115155841 14:30337884-30337906 GCTAAGTTCTGGGAATCAGGTGG - Intergenic
1116064446 14:39964723-39964745 AATAGGTTTTGGGAAACAGGTGG - Intergenic
1116090063 14:40293726-40293748 GAGATGGATTGGGAATCAGAAGG + Intergenic
1116330565 14:43592361-43592383 AATGGGTTTTGGGAAACAGGTGG + Intergenic
1119715061 14:76853251-76853273 GAATGGCTTTGGGAATGAGGTGG + Exonic
1120654802 14:87177016-87177038 TTGAGGTTTTGGGACTCAGACGG + Intergenic
1120656886 14:87201079-87201101 GAGAGGTATGGGAAAACAGGAGG + Intergenic
1121259025 14:92552975-92552997 GAGAGGTTCTGGGAGTAATGAGG - Intronic
1122294702 14:100698788-100698810 CACAGATTCTGGGAATCAGGAGG - Intergenic
1122325008 14:100876589-100876611 CATAGGTTTTGGGGAACAGGTGG + Intergenic
1122691274 14:103533155-103533177 GAGAGGTTTTGGGAAACAGCAGG - Intronic
1122811742 14:104292644-104292666 GAGAGGCTGTGGGAAAGAGGAGG - Intergenic
1125496040 15:40195002-40195024 AATAGGTTTTGGGGAACAGGTGG + Intronic
1125709075 15:41769190-41769212 GAGAGTCTTGGGAAATCAGGAGG - Exonic
1126451016 15:48809818-48809840 AAGAGGTTTAGGGAATAAAGAGG + Intronic
1127541812 15:59946813-59946835 AAGAGGTTTTGGAGATTAGGAGG + Intergenic
1128213456 15:65917889-65917911 GAGAGGTTTTGGGCAACAAAGGG + Intronic
1130354547 15:83117565-83117587 GGGAGGTTTTAGGAAGGAGGCGG + Intronic
1131123072 15:89835143-89835165 AGGAGGTTCTGGGAAGCAGGTGG + Exonic
1131347692 15:91665959-91665981 GAGAGAGTTTGGGAAACAAGGGG + Intergenic
1131415105 15:92248637-92248659 GAGAGGTTTTGGGACACATGTGG - Intergenic
1132198804 15:99933404-99933426 GAGAAGTTTGGGGGATGAGGAGG + Intergenic
1132765217 16:1531066-1531088 GAGAGGATGTGGGAATCACGCGG - Intronic
1133001510 16:2853774-2853796 GAGAGGTTGTGGGGCTCAGTGGG + Intronic
1134014703 16:10879863-10879885 GAGGGGCTGTGGGACTCAGGAGG - Intronic
1138063837 16:53919958-53919980 AGTAGGTTTTGGGAAACAGGTGG - Intronic
1138407724 16:56811442-56811464 GACAGGTTTTGGTATTCAGCAGG + Intronic
1140065658 16:71609152-71609174 GAGAGTTTTTAGGAATGAGTAGG - Intergenic
1140113182 16:72020941-72020963 GAGTGGTTTTGGTCAGCAGGCGG + Intronic
1140243095 16:73221582-73221604 GATAGTTTTTGGGGAACAGGTGG - Intergenic
1140708444 16:77653518-77653540 GAAAGGTTTTATGAATGAGGAGG - Intergenic
1140754948 16:78058686-78058708 TAGGGGTTTTGGTAATCAGCCGG + Intronic
1140875368 16:79146703-79146725 GGGAAGTTTTGAGAATTAGGTGG + Intronic
1141225974 16:82115141-82115163 GATAGTTTTTGGGGAACAGGTGG + Intergenic
1142316565 16:89350738-89350760 GAGAGTTTTAAGGAATCAGTTGG - Intronic
1143766395 17:9140562-9140584 GACAGCTTGTGGGACTCAGGAGG + Intronic
1143940512 17:10536289-10536311 AATAGGTTTTGGGGAACAGGTGG - Intronic
1144246369 17:13369780-13369802 AATAGGTTTTGGGGAACAGGTGG - Intergenic
1146055112 17:29577098-29577120 GGGAGGGTGTGGGAAGCAGGCGG - Intronic
1146484672 17:33233282-33233304 AAGAGGATTTGGGATTTAGGTGG - Intronic
1146814303 17:35930317-35930339 GAGAGGTTTGGGGAATATGAGGG - Intronic
1147498901 17:40943236-40943258 AATAGTTTTTGGGAAACAGGTGG + Intergenic
1147980829 17:44272932-44272954 GGGAGGTGCGGGGAATCAGGCGG + Intergenic
1148228516 17:45916459-45916481 GAGGGGGTTTGGGCAGCAGGTGG - Intronic
1148554129 17:48567716-48567738 GAAATGTTCTAGGAATCAGGTGG - Intronic
1149117455 17:53115082-53115104 AACAGGTTTTGGGGAACAGGTGG + Intergenic
1149717335 17:58805132-58805154 AATAGGTTTTGGGGAACAGGTGG + Intronic
1150146647 17:62774712-62774734 GACAAGATTTGGGAATCTGGAGG - Intronic
1150969921 17:70016075-70016097 GAGAGGTTGTGGATACCAGGAGG + Intergenic
1151261087 17:72916577-72916599 GAGAGGGTTTGTGAAACAGAAGG - Intronic
1151311047 17:73292593-73292615 GAGTGGGTGTGGGAGTCAGGGGG + Intronic
1151522671 17:74641530-74641552 GAGAGGATGAGGGAATCAGAGGG - Intergenic
1152929597 17:83103108-83103130 GCTCGGTTTTGGGAAGCAGGTGG - Intergenic
1156021111 18:32600031-32600053 AATAGTTTTTGGGAAACAGGTGG - Intergenic
1156343350 18:36233041-36233063 AATAGTTTTTGGGAAACAGGTGG + Intronic
1156907481 18:42371122-42371144 AATAGTTTTTGGGAAACAGGTGG + Intergenic
1157280861 18:46345431-46345453 GAGAGGTGGTGGGAAGGAGGAGG + Intronic
1159021384 18:63145952-63145974 GAGAGGTTTGGGGGATCTTGGGG - Intronic
1159058525 18:63490843-63490865 AATAGGTTTTGGGGAACAGGTGG + Intronic
1160303190 18:77705013-77705035 GAGAGGTTTGGAGAGTGAGGAGG + Intergenic
1160395407 18:78567138-78567160 GAGAGGTGTCAGGACTCAGGAGG + Intergenic
1161824897 19:6556694-6556716 GAGAGGATTTGAGAAACAGGAGG + Intergenic
1163371458 19:16903538-16903560 GTGAGGTTTTGGGGAGCACGAGG - Intronic
1163608465 19:18288585-18288607 CAGAGGGTTTGGGGATCAGAAGG + Intergenic
1164249715 19:23466218-23466240 GAGAGTTTTGGGGAAGGAGGAGG - Intergenic
1164677038 19:30107762-30107784 GAGATGTTTGGTGATTCAGGTGG - Intergenic
1165245906 19:34498258-34498280 GAGAGGACCTGGGAAGCAGGGGG - Intronic
1165711357 19:38013021-38013043 GAGGGGCTTTGGGCATCTGGGGG + Intronic
1166224537 19:41386809-41386831 GGGAGGTTAAGGGAGTCAGGTGG - Intronic
1167024227 19:46903201-46903223 GAGAGGGTTTGGGGATGAGTAGG - Intergenic
1167366092 19:49055691-49055713 GTGGGGTCTTGGGAACCAGGAGG + Exonic
1167559723 19:50218627-50218649 AATAGTTTTTGGGAAACAGGCGG + Intronic
1167597758 19:50436316-50436338 GAGAGGTTGTGTGAAGCAGAGGG + Intronic
925970924 2:9106070-9106092 CAGAAGTTTTGGGGATGAGGAGG + Intergenic
926803895 2:16686809-16686831 GAGAGGTTGAGGCAAGCAGGGGG - Intergenic
927136099 2:20097629-20097651 GAGCTGTTATGGGACTCAGGTGG - Intergenic
928052798 2:28018010-28018032 AGTAGGTTTTGGGAAACAGGTGG + Intronic
929606268 2:43236279-43236301 GAGATGTTTTGGGGATGCGGGGG + Intronic
930485280 2:52004030-52004052 GAGTTGTCTTGGGAAGCAGGTGG - Intergenic
931828758 2:66028794-66028816 AATAGGTTTTGGGAAACAGGTGG + Intergenic
931960660 2:67478835-67478857 GAGAGCATTTGCTAATCAGGTGG - Intergenic
932275024 2:70445146-70445168 GAGAGGTTTCAGGAGCCAGGGGG + Intergenic
933283778 2:80361766-80361788 GAGAGGTTTTGGGGGGAAGGAGG - Intronic
934106626 2:88700779-88700801 GAGAGGTTTTGGGAAGTGGAAGG + Intronic
934489473 2:94750540-94750562 AATAGTTTTTGGGAAACAGGTGG - Intergenic
934755426 2:96821068-96821090 GGGAGGTTTTTGGAACCTGGAGG + Intronic
937621741 2:123996204-123996226 AAGAGGTTTTAGGCAGCAGGTGG + Intergenic
938185559 2:129228949-129228971 GATGGGTTGTGGGAAGCAGGAGG - Intergenic
938996938 2:136689766-136689788 GAGGGGTTTTGGTGATCACGGGG + Intergenic
940581163 2:155583317-155583339 AATAGTTTTTGGGAAACAGGTGG + Intergenic
941698345 2:168577203-168577225 GAGAGGTTATGGAATTGAGGAGG + Intronic
942414428 2:175743987-175744009 GAGAAGTATTGGGAAAGAGGGGG + Intergenic
945834169 2:214819729-214819751 AATAGTTTTTGGGAAACAGGTGG - Intergenic
946435162 2:219646577-219646599 AATAGGTTTTGGGGAACAGGTGG + Intergenic
947444917 2:230156328-230156350 CAGACTTTTTGGGATTCAGGAGG - Intergenic
947523440 2:230865148-230865170 GAGAGGGTCTGGGGCTCAGGCGG + Intronic
947646818 2:231748390-231748412 GAGAGATTTAGGGTATCTGGTGG + Intronic
948129462 2:235589853-235589875 GAAAGGGTTTGGGAATGAGTAGG + Intronic
948185515 2:236018615-236018637 GAGAGGTGTTAGGAAACAAGGGG + Intronic
948304341 2:236935552-236935574 GAGAGGCTGTGGGAAGGAGGAGG + Intergenic
948365368 2:237451241-237451263 GAGAATCTTTGGGAACCAGGAGG - Intergenic
948941926 2:241201027-241201049 GAGGGGTTCTGGGTATCTGGGGG + Intronic
1170012167 20:11736091-11736113 GAGAGTTCTTGGGAAGCAGGTGG - Intergenic
1170772593 20:19346814-19346836 AATAGGTTTTGGGGATCAGGTGG - Intronic
1171072169 20:22081464-22081486 AATAGTTTTTGGGAAACAGGTGG + Intergenic
1171879417 20:30606487-30606509 AATAGTTTTTGGGAAACAGGTGG - Intergenic
1172003958 20:31804430-31804452 GAGAAATTTTGGGAAGCAAGAGG - Intergenic
1172012759 20:31855957-31855979 CATAGGTTTTGGGGAACAGGTGG + Intronic
1172135791 20:32685900-32685922 GAGAGGCTTATGGAATAAGGCGG - Intergenic
1173335485 20:42109316-42109338 GAGAGGCGTTGGGAAGGAGGGGG + Intronic
1174677438 20:52372016-52372038 GAGAGGTTTCGGGAAGTACGTGG - Intergenic
1175645317 20:60666060-60666082 CATAGGTTTTGGGGAACAGGTGG - Intergenic
1175813133 20:61869640-61869662 GAGAGGGTTTGGCATTGAGGAGG - Intronic
1176037397 20:63046481-63046503 GAGAGGTTTTGGGAATCTGTGGG + Intergenic
1177395924 21:20536307-20536329 TTGAGGTTTTGGGACTCGGGAGG - Intergenic
1178297876 21:31426039-31426061 AATAGTTTTTGGGGATCAGGCGG + Intronic
1179880355 21:44291013-44291035 GAGCTGTTTTGGGAAGGAGGTGG + Intronic
1180055669 21:45358083-45358105 GAGAGGGCATGGGACTCAGGAGG - Intergenic
1180737666 22:18030343-18030365 GAATCGTTTTGGGAATCAGAAGG - Intergenic
1181567737 22:23750139-23750161 GAGAGGGATTGGCAATAAGGAGG - Intronic
1184085168 22:42257790-42257812 GAGGCATTTTGGGAAACAGGTGG - Intronic
1184226905 22:43134238-43134260 GGGAGGTTTTTGGCATCAAGAGG - Intronic
950052685 3:10004327-10004349 GGGTTGTTTTGGGATTCAGGTGG - Intronic
950690804 3:14655475-14655497 GAGATTTTTTGGCAATCATGTGG + Intronic
951199453 3:19861174-19861196 AATAGTTTTTGGGAAACAGGTGG - Intergenic
953738142 3:45513723-45513745 GGGAAGTTCGGGGAATCAGGGGG - Intronic
953929671 3:46999623-46999645 GAGAGGTTCAGGCAATCTGGGGG - Exonic
953939045 3:47074646-47074668 TAGATGATTTGGGTATCAGGAGG - Intronic
954472621 3:50711080-50711102 AATAGTTTTTGGGAAACAGGTGG - Intronic
954863734 3:53711692-53711714 GAGAGGTTATGGGACGCAGATGG + Intronic
956700509 3:71954927-71954949 GAGAGGTTTTCGGCATCGGGTGG - Intergenic
956863609 3:73348383-73348405 CATAGGTTTTGGGGAACAGGAGG - Intergenic
957254563 3:77820142-77820164 TCGAGGTTTTGGGACTCAGATGG + Intergenic
959305120 3:104653755-104653777 GAGAGTTGTTTGGACTCAGGAGG - Intergenic
959362389 3:105409679-105409701 TATAGGTTTTGGGGAACAGGTGG - Intronic
962140334 3:132783744-132783766 GACAGGTGTCTGGAATCAGGAGG - Intergenic
964325484 3:155541522-155541544 GAGAGAGATGGGGAATCAGGTGG + Intronic
964499642 3:157334716-157334738 GAGAAGTACTGGGAATCACGGGG + Intronic
964837112 3:160951278-160951300 GATAGGTTAAGGGATTCAGGGGG - Intronic
967075212 3:185995775-185995797 GAGACATGTTGGGAATCAAGAGG + Intergenic
970458780 4:16252087-16252109 CATAGGTTTTGGGGAACAGGTGG + Intergenic
971693736 4:29871382-29871404 AATAGTTTTTGGGAAACAGGTGG + Intergenic
974133281 4:57783348-57783370 AAGAGTTTTTGGGGAACAGGTGG + Intergenic
975098094 4:70480986-70481008 GTGAGGATTTGGGAATTTGGGGG - Exonic
975624564 4:76331679-76331701 ATGAACTTTTGGGAATCAGGAGG + Intronic
976303856 4:83540238-83540260 AAGAGGATTTGGAAATTAGGTGG + Intronic
976835832 4:89372331-89372353 CAGAGATTTTGAGAATGAGGGGG + Intergenic
977634381 4:99280200-99280222 GAGAGGTTTTGGGAATCAGGAGG + Exonic
977637059 4:99311577-99311599 GAGAGGTTCTGGGAAGCAGGAGG + Exonic
977639504 4:99340631-99340653 GAGAGGTTCTGGGAATCAGGAGG + Exonic
978592214 4:110336553-110336575 GAGAAGTTTTTGGAAACATGAGG + Intergenic
981228633 4:142326443-142326465 GTGAGGCTTTGGGAGTCAGCAGG - Intronic
984851920 4:184162003-184162025 AATAGGTTTTGGGGAACAGGTGG - Intronic
985377252 4:189354737-189354759 GAAAGGTTTTAGGAAATAGGTGG + Intergenic
985658933 5:1146140-1146162 GAGAGCCTTTGGGAATGAGGAGG - Intergenic
987723685 5:21669554-21669576 GACAGTGTTTGGCAATCAGGTGG + Intergenic
988453058 5:31362426-31362448 TAGAGGTTTAGAGAGTCAGGGGG - Intergenic
988965782 5:36416391-36416413 TTGAGGTTTTGGGACTCAGACGG - Intergenic
992134731 5:73733007-73733029 AATAGGTTTTGGGGAACAGGTGG + Intronic
993445127 5:88002391-88002413 CATAGGTTTTGGGGAACAGGTGG + Intergenic
993504701 5:88694754-88694776 GAGAAGTCTTGGGAATCAAACGG + Intergenic
994105509 5:95944129-95944151 GAGAAGTTTTGGGAAGCATTTGG - Intronic
994307289 5:98221993-98222015 AATAGTTTTTGGGAAACAGGAGG - Intergenic
994943553 5:106356450-106356472 GAGAGCTTGTGAGAATGAGGAGG + Intergenic
995473406 5:112525778-112525800 TGGAGGTTTTGGTAATCAGCTGG - Intergenic
996136322 5:119846674-119846696 CATAGGTTTTGGGGAACAGGTGG - Intergenic
996613696 5:125414300-125414322 TAGAGCTTTTAGGAATGAGGTGG + Intergenic
997749541 5:136330950-136330972 GAGAGGTTATGGGAATGGGTGGG + Intronic
999100344 5:149018719-149018741 GACAGGTTTTGGTGATCAGCTGG - Intronic
999309801 5:150544785-150544807 GAGGGGTTGTGGGTAGCAGGAGG + Intronic
1000887961 5:166769251-166769273 GAGAGATTTGGGGATTCTGGTGG + Intergenic
1004464119 6:15867851-15867873 AATAGTTTTTGGGAAACAGGTGG + Intergenic
1005205526 6:23399153-23399175 CATAGGTTTTGGGGAACAGGTGG + Intergenic
1006354449 6:33546378-33546400 GAGAGTTTTTGAGAATTTGGAGG + Intergenic
1007029770 6:38617350-38617372 GAGAGGCATTGGGACCCAGGAGG - Intronic
1007776006 6:44224728-44224750 GAGAGGTGTTGGGAGTCTGGAGG + Intronic
1008618917 6:53252860-53252882 AATAGGTTTTGGGGAACAGGTGG + Intergenic
1010512663 6:76739669-76739691 TAGATTTTTTGGGAAACAGGTGG + Intergenic
1011402245 6:86976135-86976157 AAGAGGTTATGGAAAACAGGAGG + Intronic
1011566007 6:88672679-88672701 AATAGGTTTTGGGAAACAGGTGG - Intronic
1011918931 6:92547165-92547187 GAGAGATTTAGGGTATCTGGCGG + Intergenic
1014036928 6:116777399-116777421 AATAGTTTTTGGGAAACAGGTGG + Intergenic
1015971722 6:138749163-138749185 CACAGGTTCTGGGAAACAGGAGG + Intergenic
1019488201 7:1299091-1299113 GAGAGGCTTTGGCAAGCTGGAGG - Intergenic
1021530016 7:21633725-21633747 GAGAGGCTTTGTGATTAAGGTGG + Intronic
1021753959 7:23833248-23833270 GAGAGATTTAGGGCATCTGGTGG + Intergenic
1021914268 7:25415620-25415642 GAGTGGTTTTGAGAGTCATGGGG + Intergenic
1022658448 7:32343374-32343396 AAGAGGTTCTACGAATCAGGTGG - Intergenic
1023740410 7:43276005-43276027 CAGAGGTTTAAGGAATAAGGAGG + Intronic
1025823147 7:64990320-64990342 TATATGTTGTGGGAATCAGGAGG + Exonic
1025824516 7:64999340-64999362 AAAATGTTGTGGGAATCAGGAGG + Intronic
1027648115 7:80830680-80830702 GAAAGGTCTTTGGAAACAGGGGG + Intronic
1027693116 7:81373259-81373281 AATAGGTTTTGGAAAACAGGTGG + Intergenic
1028792326 7:94866927-94866949 AATAGGTTTTGGGGAACAGGTGG + Intergenic
1028988397 7:97025183-97025205 CACATGTTTTGGGAATGAGGTGG + Intergenic
1033237693 7:139651129-139651151 GTGATGTGTTGGGTATCAGGGGG - Intronic
1034145523 7:148867855-148867877 GAGATGTTTAGGGTATCTGGCGG - Intronic
1035820751 8:2589243-2589265 GAGAGGTTTTCTGGATCTGGGGG + Intergenic
1037170925 8:15890838-15890860 AATAGGTTTTGGGGAACAGGTGG + Intergenic
1037612914 8:20491426-20491448 GGGAGGGTTGGGGAATGAGGAGG + Intergenic
1037683092 8:21115098-21115120 CAGAGGTTTTGAGAATCTGGGGG - Intergenic
1038397704 8:27259138-27259160 GTAAGTTTTTGGGAAACAGGTGG + Intergenic
1038693562 8:29784648-29784670 GTAAGGTTTTGGGTATCAGCAGG + Intergenic
1038721737 8:30042749-30042771 AATAGTTTTTGGGAAACAGGTGG + Intergenic
1039128403 8:34231089-34231111 CATAGGTTTTCGGAAACAGGTGG + Intergenic
1040288229 8:46111235-46111257 GAGGGGTGTGGGGACTCAGGGGG - Intergenic
1041530584 8:58861289-58861311 CAGATGTTTTGGGAATCAGAGGG - Intronic
1042043780 8:64624763-64624785 AACAGTTTTTGGGGATCAGGTGG + Intronic
1042084585 8:65093641-65093663 AACAGTTTTTGGGAAACAGGTGG - Intergenic
1042207205 8:66341452-66341474 GAGAGGTTATGAGCCTCAGGAGG + Intergenic
1042716239 8:71775965-71775987 TAGAGGTAATGGGAATCATGAGG - Intergenic
1042900901 8:73726403-73726425 AACAGTTTTTGGGAAACAGGTGG - Intronic
1044066638 8:87706821-87706843 GAGAGATTTAGGGTATCTGGGGG - Intergenic
1046101256 8:109616593-109616615 AAAATGTTTTGGGAATGAGGTGG + Intronic
1046973067 8:120244403-120244425 CATAGGTTTTGGGGAACAGGTGG + Intronic
1048530563 8:135245143-135245165 AATAGGTTTTGGGGAACAGGTGG + Intergenic
1052260270 9:26507217-26507239 GAGATGATTTGGGAAGCAAGAGG + Intergenic
1052980948 9:34448970-34448992 GATAGTTTTTGGGGAACAGGTGG - Intronic
1053101630 9:35376351-35376373 GATAGGGTTTCAGAATCAGGTGG - Intronic
1053259081 9:36645982-36646004 GAGTGATTTTGGCACTCAGGGGG + Intronic
1053262014 9:36675347-36675369 AAAAGCTTTTGGGAATGAGGTGG - Intronic
1053668310 9:40333733-40333755 AATAGTTTTTGGGAAACAGGTGG + Intergenic
1053918116 9:42960027-42960049 AATAGTTTTTGGGAAACAGGTGG + Intergenic
1054379452 9:64473785-64473807 AATAGTTTTTGGGAAACAGGTGG + Intergenic
1054516302 9:66042560-66042582 AATAGTTTTTGGGAAACAGGTGG - Intergenic
1057700524 9:97360495-97360517 GAGAGGATGTGGGCATCAGGTGG - Intronic
1058075278 9:100644430-100644452 TACATGTTTTGGGGATCAGGAGG + Intergenic
1058593344 9:106588548-106588570 GAGAGGTTCTGGGTATCTGAGGG - Intergenic
1059476799 9:114553877-114553899 GAGAAGTTTTGCAAATCAGCTGG - Intergenic
1060091615 9:120748145-120748167 GAGGGGTTTTGGGAGCCGGGCGG + Intergenic
1062127363 9:134870786-134870808 GAGAGGTTTTAGGACGAAGGTGG + Intergenic
1062603759 9:137333270-137333292 TTGAGGTTTTGGGACTCAGACGG + Intronic
1186319965 X:8413574-8413596 GTGAGGTTTTGGGAAGCTGGAGG - Intergenic
1191645420 X:63475441-63475463 CAGATGTTGTGGGAATCAGGAGG - Intergenic
1193015849 X:76733241-76733263 CATAGGTTTTGAGAAACAGGTGG - Intergenic
1193095276 X:77541480-77541502 GCCAGGTTTTGGTATTCAGGAGG - Intronic
1193745595 X:85275768-85275790 AAGAGGGTTTTGGAATCAGATGG - Intergenic
1194482983 X:94449844-94449866 CACAGGTTTTGGGGAACAGGTGG - Intergenic
1196362435 X:114879472-114879494 CATAGGTTTTTGGAAACAGGTGG + Intronic
1196505317 X:116435169-116435191 GAGAGATTATGGGAATCACAAGG - Intergenic
1198083712 X:133263502-133263524 GGGAGGTTTTGGGAATCAGCTGG - Intergenic
1198328599 X:135599708-135599730 GAGGAGTTTTGGGAATATGGTGG - Intergenic
1198361231 X:135897346-135897368 GAGGAGTTTTGGGAATGTGGTGG - Intronic
1199001444 X:142642510-142642532 AATAGTTTTTGGGAAACAGGTGG + Intergenic
1199530063 X:148836650-148836672 GATAAGTTTTGTGAAGCAGGAGG - Intronic