ID: 977635603

View in Genome Browser
Species Human (GRCh38)
Location 4:99294155-99294177
Sequence CTGGCTTTGGACTGGTACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977635603_977635609 -10 Left 977635603 4:99294155-99294177 CCCCAGTACCAGTCCAAAGCCAG No data
Right 977635609 4:99294168-99294190 CCAAAGCCAGGTAGCTCCACTGG No data
977635603_977635610 -9 Left 977635603 4:99294155-99294177 CCCCAGTACCAGTCCAAAGCCAG No data
Right 977635610 4:99294169-99294191 CAAAGCCAGGTAGCTCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977635603 Original CRISPR CTGGCTTTGGACTGGTACTG GGG (reversed) Intergenic
No off target data available for this crispr