ID: 977639185

View in Genome Browser
Species Human (GRCh38)
Location 4:99335871-99335893
Sequence CTTTATATGTAGATATTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 217}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977639185_977639190 25 Left 977639185 4:99335871-99335893 CCACCCAATATCTACATATAAAG 0: 1
1: 0
2: 1
3: 13
4: 217
Right 977639190 4:99335919-99335941 ATACTTCATTTTCAGTCAATTGG 0: 1
1: 1
2: 1
3: 19
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977639185 Original CRISPR CTTTATATGTAGATATTGGG TGG (reversed) Intergenic
901256518 1:7832782-7832804 CATTAAATGTTTATATTGGGGGG - Intronic
901468685 1:9440669-9440691 CCTAATATGGAGATGTTGGGAGG - Intergenic
902464133 1:16604461-16604483 TTTTATATGTACATAAAGGGAGG + Intronic
903156965 1:21452217-21452239 TTTTATATGTATATAAAGGGAGG - Intronic
903609315 1:24598570-24598592 CTATATAAATATATATTGGGTGG + Intronic
908139211 1:61166211-61166233 CATTATAGGTAGATATTGAATGG - Intronic
908447124 1:64209766-64209788 CTTTATATGTACTTTTTGGTAGG - Intronic
908931605 1:69322824-69322846 CTTTATATGTGAATAATAGGGGG + Intergenic
909991564 1:82229045-82229067 CTTTTTTTGTTGACATTGGGAGG + Intergenic
910335141 1:86119793-86119815 ATTTATAAATAGATATTTGGAGG + Intronic
912227094 1:107746350-107746372 ATGTCTATGCAGATATTGGGAGG - Intronic
912908631 1:113733857-113733879 CTTTATAAATAGGTAATGGGTGG + Intronic
913173012 1:116249333-116249355 CTTTATATGTGATTATTTGGTGG + Intergenic
913443848 1:118928570-118928592 CTGTATATGTAAATGTTTGGAGG + Intronic
917312479 1:173691400-173691422 CTTTATATGTAACAATTTGGGGG - Intergenic
920574939 1:207052536-207052558 CTTTAATTCTAGATACTGGGAGG + Intronic
920762345 1:208797373-208797395 CTTTATATGTAGACATAATGGGG - Intergenic
922170127 1:223147124-223147146 GTTTATATGGAGACAATGGGGGG + Intergenic
1066122814 10:32307615-32307637 CTTTATGTGTGTATATGGGGTGG + Intronic
1066377535 10:34870976-34870998 CTTTATTTTTAGAAATTGGCAGG + Intergenic
1066523116 10:36244724-36244746 TTTTATTTGTAGATATTTAGGGG - Intergenic
1067378220 10:45747879-45747901 CTATATATGAAAATATTGGCTGG - Intronic
1067885921 10:50088554-50088576 CTATATATGAAAATATTGGCTGG - Intronic
1068280866 10:54867781-54867803 ATTTGTATATAGATATTGGAGGG - Intronic
1069223537 10:65912502-65912524 CATTTTATGTTGATATTTGGTGG - Exonic
1069267534 10:66481107-66481129 GTTTATATGTATAAATTGGTAGG + Intronic
1071175482 10:82922111-82922133 CTATATATATAGAGACTGGGGGG + Intronic
1071891832 10:90016706-90016728 CTTTATAAGTTAATATTGGTAGG + Intergenic
1071941310 10:90594622-90594644 ATTTATAGGTAAATATTGGGTGG - Intergenic
1072357588 10:94626342-94626364 ATTTAAAAGAAGATATTGGGAGG + Intergenic
1073985705 10:109206232-109206254 CTTTATCTGTGGTTCTTGGGAGG - Intergenic
1078000971 11:7495336-7495358 CTTTATATGTTATTTTTGGGGGG - Intronic
1078033522 11:7779350-7779372 ATTTTTATATAGATATTGGATGG - Intergenic
1079637892 11:22768159-22768181 CTCTTTATGTAGGTTTTGGGAGG + Intronic
1080008822 11:27437053-27437075 GTTTCTATCTAAATATTGGGTGG - Intronic
1081846082 11:46241420-46241442 CATTATATGTAGGTGCTGGGAGG + Intergenic
1083240196 11:61382198-61382220 TTTTATTTTTAGAGATTGGGGGG - Intergenic
1085467396 11:76733600-76733622 CTCAATGTGGAGATATTGGGAGG - Intergenic
1088821022 11:113457585-113457607 ATTTACATGTAAATAGTGGGGGG - Intronic
1092532059 12:9352967-9352989 CTTTTTATGGACATATTGTGAGG + Intergenic
1092734762 12:11570139-11570161 TTTTATTTTTAGATATTGGTAGG + Intergenic
1094745509 12:33340315-33340337 CTTTATATGCAAATTTTGGCAGG + Intergenic
1099387923 12:82040440-82040462 ATTTATATATAAATAATGGGAGG - Intergenic
1102509311 12:113403537-113403559 TTTTTTTTGTAGAGATTGGGGGG + Intronic
1102580402 12:113882740-113882762 GCTTTTATGTAGATTTTGGGTGG - Intronic
1106010856 13:25820622-25820644 ATTTATATTTAGGAATTGGGTGG + Intronic
1108248818 13:48544668-48544690 CTTTATCTGTATGTATGGGGAGG - Intergenic
1109527152 13:63591093-63591115 CTTTGTATGTAGTTATTAGGGGG - Intergenic
1109712165 13:66176128-66176150 CTTTATATGTATATAAAGGAGGG + Intergenic
1111487225 13:88919601-88919623 ATTTAACTGTAAATATTGGGAGG + Intergenic
1116201301 14:41801211-41801233 TTTTATATGCAGATATGGAGTGG - Intronic
1119423585 14:74522341-74522363 CCTTATTTGAAAATATTGGGGGG + Intronic
1124831020 15:33149259-33149281 ATATATATTTATATATTGGGAGG + Intronic
1125126436 15:36227662-36227684 CTTTTTTTGTAGAAATGGGGGGG - Intergenic
1125386487 15:39142345-39142367 TTTTATTTGTAGAGATGGGGGGG - Intergenic
1126445544 15:48739683-48739705 GTGTATGTGTAGGTATTGGGTGG - Intronic
1130699801 15:86166769-86166791 CTTGATATGTTGATATTGGATGG + Intronic
1136646770 16:31626637-31626659 CTTTATATGTAATTATTGATAGG - Intergenic
1136658406 16:31729648-31729670 CTTTATATGTAATTATTGATAGG + Intronic
1136704636 16:32176720-32176742 CTTTAAATGTGTATATTAGGGGG + Intergenic
1136763277 16:32752686-32752708 CTTTAAATGTGTATATTAGGGGG - Intergenic
1136804823 16:33117700-33117722 CTTTAAATGTGTATATTAGGGGG + Intergenic
1137026704 16:35483579-35483601 TTTAATATGTAGATTTTTGGAGG - Intergenic
1140110486 16:72000031-72000053 CTTTAAATATATATATTGGCGGG + Intergenic
1203065428 16_KI270728v1_random:1013008-1013030 CTTTAAATGTGTATATTAGGGGG - Intergenic
1143168766 17:4913594-4913616 TTTTTTTTGTAGAGATTGGGGGG - Intergenic
1146828165 17:36042161-36042183 CTTTATTTGCAAATATTTGGGGG + Intergenic
1148147521 17:45375353-45375375 TTTTTTTTGTAGAGATTGGGGGG + Intergenic
1153892268 18:9528588-9528610 TTTTATATGTAGATAATTGTTGG - Intronic
1154080326 18:11250011-11250033 CTTATGATGAAGATATTGGGAGG + Intergenic
1155976475 18:32137210-32137232 ATTTATATGTGGGTATTTGGAGG - Intronic
1157153783 18:45244907-45244929 CTTTATTGGTAGGTATTGGCTGG - Intronic
1158405915 18:57158968-57158990 CCTTAAAAGTAGAAATTGGGAGG - Intergenic
1158631660 18:59120507-59120529 CTTAATTTGTAAATTTTGGGGGG + Intergenic
1159297583 18:66516040-66516062 CTTAATACTTAAATATTGGGGGG + Intronic
1159326174 18:66922115-66922137 CTTTTTATGTACATATTCAGAGG + Intergenic
1159613915 18:70557590-70557612 CTATATATGTAGAGATTGTAGGG - Intergenic
1162530871 19:11235811-11235833 CTTTATATTTGGAAAGTGGGCGG - Intronic
1164418381 19:28065630-28065652 ATTTATCTTTAGGTATTGGGTGG + Intergenic
1202679792 1_KI270711v1_random:41901-41923 TTTTATATGTACATAAAGGGAGG + Intergenic
926013422 2:9426599-9426621 CTTTAAATGTTGATATTCCGAGG - Intronic
928621684 2:33095312-33095334 GTTTATATATAGATGTTTGGGGG - Intronic
928722839 2:34140514-34140536 TTTTATCTGTAAATATTTGGGGG + Intergenic
929376560 2:41293999-41294021 TTTTGCATTTAGATATTGGGTGG - Intergenic
930582639 2:53230517-53230539 CTTGATATGTAGAGATTCTGGGG - Intergenic
931080482 2:58763835-58763857 GTTTATATGTAGCAACTGGGAGG + Intergenic
933279103 2:80312827-80312849 CTTTAAAGGTAGATATTAGAAGG - Intronic
937670754 2:124535078-124535100 TTTTATATGTATAGATTGTGAGG - Intronic
938750290 2:134321682-134321704 CTTCTTATGCAGATATCGGGTGG + Intronic
939759773 2:146160417-146160439 CTTTAAATGTATAATTTGGGAGG - Intergenic
940629267 2:156217235-156217257 ATATATATGTATATATTGGGGGG - Intergenic
940778405 2:157907690-157907712 CTTAATATGTAAATTTTGGAGGG + Intronic
944153383 2:196585957-196585979 TTTTGCATGAAGATATTGGGTGG - Intronic
944548578 2:200823409-200823431 CTATGTATGTAGTCATTGGGGGG + Intronic
944757988 2:202783888-202783910 ATTTATATGTATATGATGGGGGG + Intronic
944782197 2:203030702-203030724 CTTCATATGTTGATATTAGAAGG + Intronic
945279149 2:208018884-208018906 CTTTATATGTAGATATAGAGTGG - Intronic
945836116 2:214837787-214837809 CTTTATTTGCAGGTCTTGGGAGG + Intergenic
947556807 2:231100155-231100177 CTTTATATGTAACAATTTGGGGG - Intronic
1168823355 20:792294-792316 CTTTATATGTAACAATTTGGGGG + Intergenic
1169234701 20:3921476-3921498 CATTATATATATATATGGGGGGG - Intronic
1169594138 20:7178654-7178676 CATTATAAGTAAATATTAGGTGG + Intergenic
1169719133 20:8654039-8654061 TTTCATATGCATATATTGGGGGG + Intronic
1173203280 20:40969824-40969846 ATTTTTATGTAGAAATTTGGAGG - Intergenic
1174044689 20:47725293-47725315 TTTTATATGTAAATACTGGAGGG - Intronic
1174794805 20:53513075-53513097 TTTTTTTTGTAGAGATTGGGGGG - Intergenic
1175141069 20:56860410-56860432 CTTTATATGCATGTATTTGGGGG - Intergenic
1177210557 21:18066004-18066026 CTATAGATTTATATATTGGGAGG - Intronic
1177371629 21:20211422-20211444 CTTTATAAGCAGATATTGTAAGG - Intergenic
1178708508 21:34893596-34893618 CATTATATGTAGATATTCAAAGG - Intronic
1178764402 21:35435954-35435976 TTTTATATCTAGACATTTGGTGG - Intronic
1178892909 21:36534827-36534849 CCTTATATTTAAATATTGAGTGG + Intronic
1181920759 22:26318749-26318771 CCCTATAAGTAGATATAGGGAGG - Intronic
951479923 3:23149246-23149268 CTTGGTATGTAGATTTTGGAAGG - Intergenic
951993693 3:28703834-28703856 ATTTATATGTAGATTTTTGGGGG + Intergenic
952512652 3:34072651-34072673 CCTTATTTGTGGATCTTGGGAGG - Intergenic
952616964 3:35285285-35285307 CTTTATATGTATTTATAGGCAGG - Intergenic
952675431 3:36024586-36024608 CTTTATTTTTAGCTATTGGCTGG - Intergenic
952805732 3:37349596-37349618 TTTTACCTGTAGGTATTGGGAGG + Intronic
953739433 3:45524382-45524404 CATAATATGTGGATACTGGGGGG - Intronic
955308046 3:57854298-57854320 TTTTAAATGTATATATTGGCCGG + Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956495707 3:69823557-69823579 CTTAATATGATGATATTCGGTGG - Intronic
957572397 3:81964073-81964095 CTTTGTATGATGATATTGAGAGG - Intergenic
958107421 3:89094319-89094341 CTTTATATATACATAGTAGGTGG + Intergenic
960317832 3:116199891-116199913 CTATAGATGTTTATATTGGGTGG + Intronic
960355258 3:116644644-116644666 CTATGTATGTAGTCATTGGGGGG - Intronic
963523515 3:146386720-146386742 TTATATATGTAGAAAGTGGGTGG + Intergenic
963798299 3:149653446-149653468 CTTTTTATTTAGAGATGGGGTGG + Intronic
965553604 3:169996863-169996885 CTTTACATGAAGATATTATGAGG - Exonic
965582963 3:170288753-170288775 TTTTATATGTATATATTTTGAGG - Intronic
967541298 3:190670826-190670848 CTTTAATTGTAGACTTTGGGTGG - Intergenic
967999996 3:195198940-195198962 GTTAATAAGTAAATATTGGGAGG + Intronic
970052842 4:11935091-11935113 CATTACATGTCGATATTGGTGGG - Intergenic
970093049 4:12431099-12431121 CTTTATTTGTAATAATTGGGGGG - Intergenic
971406985 4:26330735-26330757 CTTTAAAGGAAGATATTGTGAGG + Intronic
972115147 4:35622390-35622412 CTTTGTATGTATTTTTTGGGTGG - Intergenic
972435663 4:39032604-39032626 GTTTATATTTATAAATTGGGTGG - Intronic
972876122 4:43362586-43362608 CTTTATATATCCAGATTGGGTGG - Intergenic
974166909 4:58215306-58215328 TTTTCCATGTAGATATTTGGTGG - Intergenic
974554177 4:63422659-63422681 TTTTATATGTAAAAATTAGGTGG + Intergenic
975115669 4:70678005-70678027 ATTTATATTTAGATATCAGGAGG + Intronic
975546499 4:75565707-75565729 TTTTGCATGTAGATCTTGGGAGG - Intronic
976314945 4:83650054-83650076 CTCTATATGTATATATTTGGGGG + Intergenic
977147866 4:93468546-93468568 CTTTATAGATAGATATCTGGAGG + Intronic
977639185 4:99335871-99335893 CTTTATATGTAGATATTGGGTGG - Intergenic
978462327 4:108969887-108969909 TTTTATATATATATATTTGGTGG - Intronic
982364720 4:154564485-154564507 CTTAATATGTAAAGATTCGGAGG - Intronic
982723916 4:158885334-158885356 CTGAATATGTACAGATTGGGTGG + Intronic
982800442 4:159698982-159699004 CTGAATATGTAGATATTGGTGGG + Intergenic
983128674 4:163986951-163986973 CTTTATGTGAACATATTGGGTGG - Intronic
983353188 4:166620940-166620962 CTCTATATTTAGATATTGGAGGG - Intergenic
983955677 4:173696300-173696322 CTTTTTATGTAAAAATTGGTTGG - Intergenic
984838589 4:184046925-184046947 CTTCATATTTAGATTTTTGGAGG + Intergenic
986479485 5:8171494-8171516 CTTTTTATGTTGATTTTTGGTGG + Intergenic
987465931 5:18271857-18271879 CTTCATATGTAGAAAGTTGGAGG - Intergenic
987495083 5:18632714-18632736 TTTGAGATGTAAATATTGGGGGG - Intergenic
987810755 5:22832332-22832354 ATATATCTGTAAATATTGGGAGG + Intronic
988465057 5:31482137-31482159 CTTTAACTGCTGATATTGGGTGG + Intronic
989665160 5:43845770-43845792 CTTCATATGTAGATAAGGGAAGG - Intergenic
991121724 5:63023619-63023641 ATATTTATGTAGGTATTGGGTGG - Intergenic
991334944 5:65536636-65536658 ATATATATGTAGGGATTGGGGGG + Intronic
996007422 5:118439542-118439564 CTTTATATGTTGAGGGTGGGTGG - Intergenic
997142955 5:131402157-131402179 CTTTTAATGTATATATTGGTTGG - Intergenic
997386471 5:133476835-133476857 CTTTATATATACATATATGGTGG + Intronic
999671540 5:153962903-153962925 TTTAATATGTGGATTTTGGGGGG + Intergenic
1000763350 5:165253953-165253975 CATTATATCTAAATATTGGCAGG + Intergenic
1002509660 5:179705667-179705689 CTTTATGTGTAGATCATGGAAGG + Exonic
1004863005 6:19824857-19824879 CTATCTATATAGATATTGGTTGG + Intergenic
1007222361 6:40288936-40288958 CTTTATAAGGAGTCATTGGGGGG + Intergenic
1007234721 6:40382328-40382350 CTTTAGATGTGGACAGTGGGTGG + Intergenic
1007289730 6:40776303-40776325 CTTTATGTGTTGAGGTTGGGGGG + Intergenic
1007505127 6:42329604-42329626 CTTTATATCTATATATTCGCTGG - Intronic
1008324329 6:50159360-50159382 ATTTATATATAGAAAATGGGGGG + Intergenic
1013153753 6:107473179-107473201 GTTAATATGTTTATATTGGGGGG + Intergenic
1013580469 6:111529175-111529197 CTTTATAAGTAGATAGAGTGGGG + Intergenic
1015904373 6:138102029-138102051 CTTTTTATGTATTTTTTGGGGGG - Intronic
1016093246 6:140004728-140004750 CTATATATGTATACATTGTGTGG - Intergenic
1016648520 6:146437724-146437746 CTTGATCTGTAGATCTTGTGTGG - Intergenic
1020288540 7:6705287-6705309 CTTTCTGTGTAGGTTTTGGGCGG - Intronic
1021647200 7:22800155-22800177 CTTTACATGTATATATCAGGTGG + Intergenic
1021928689 7:25557875-25557897 GTTTAAATGTATACATTGGGGGG + Intergenic
1022057095 7:26748946-26748968 CTTTCAATGTAGATAATAGGAGG + Intronic
1023954988 7:44878033-44878055 CTTTATATTTAGAAATAGGATGG - Exonic
1026326596 7:69315795-69315817 CTTTATAAGAAGATCTTGAGAGG - Intergenic
1027552201 7:79612973-79612995 CAGTATATTTGGATATTGGGTGG - Intergenic
1027617345 7:80439745-80439767 TTTTACATGTAGATATGGAGTGG + Intronic
1028728537 7:94117608-94117630 ATATATATGAAGAAATTGGGTGG - Intergenic
1028819236 7:95187019-95187041 CTTTATATGATGATTTAGGGAGG + Intronic
1029065982 7:97848718-97848740 CTTTAAAAGTAGATTTTAGGTGG + Intergenic
1030159736 7:106494757-106494779 ATATATATATACATATTGGGTGG - Intergenic
1030504691 7:110406150-110406172 ATTTATATATACATTTTGGGGGG + Intergenic
1030676384 7:112390175-112390197 GTGTATATGTATATATGGGGTGG - Intergenic
1030975824 7:116121900-116121922 ATTAAAATGTAGCTATTGGGAGG + Intronic
1032773235 7:135081346-135081368 CTTTATATGTAAATAAATGGTGG + Intronic
1034708801 7:153172368-153172390 CTTTATATGTCTATTTTTGGGGG + Intergenic
1036458226 8:8928234-8928256 CTGAATATGTAGAAATTGGATGG + Intergenic
1037244220 8:16813201-16813223 CTTTATATGTAAATGCTTGGTGG + Intergenic
1038845204 8:31222613-31222635 CATTTTATGAAGAAATTGGGGGG + Intergenic
1040989045 8:53329390-53329412 CTTATTATGTAGATGTTGGCAGG - Intergenic
1041044011 8:53874898-53874920 TTTAATATGTAAATTTTGGGAGG + Intronic
1041900052 8:62972358-62972380 ATAAATATGTATATATTGGGGGG + Intronic
1043711089 8:83419855-83419877 CTTTGCATGTAGATATATGGTGG - Intergenic
1044051661 8:87513644-87513666 TTTTACATGTACATATTGGCCGG - Intronic
1044885532 8:96772968-96772990 CTTTATATTTAAAAATGGGGTGG - Intronic
1045853329 8:106730689-106730711 TTTTAGATGTAGATTTTGTGTGG + Intronic
1048904401 8:139073957-139073979 CTGCTTATGTAGCTATTGGGAGG + Intergenic
1050176906 9:2877779-2877801 CTTTATATGGAGATTCTGGCAGG + Intergenic
1050218345 9:3356058-3356080 CTTTAAATATATATATTAGGGGG + Intronic
1050707680 9:8421805-8421827 CTTTATATTTAAATATTAAGTGG - Intronic
1051779591 9:20674879-20674901 CTTATTAAGTAGGTATTGGGGGG - Intronic
1053176576 9:35929720-35929742 CTACACAGGTAGATATTGGGTGG - Intergenic
1055181154 9:73388624-73388646 CTCTACCTGTAGAAATTGGGGGG - Intergenic
1059813587 9:117885240-117885262 CTTTACCTGTAGTTATTTGGGGG - Intergenic
1061675818 9:132215061-132215083 ATTTTTTTGTAGAGATTGGGGGG + Intronic
1187068416 X:15863822-15863844 CTTTATATAAGGATATTGGAGGG + Intergenic
1189712297 X:43826182-43826204 CTTTATTTGTGGAATTTGGGTGG + Intronic
1189980325 X:46504186-46504208 CTTTATTGGTGGATATTTGGTGG - Intronic
1191190904 X:57666180-57666202 TTTTATAGGTAGAAAATGGGAGG - Intergenic
1192084005 X:68077226-68077248 CTTTATAAGCTGTTATTGGGAGG + Intronic
1194164607 X:90499543-90499565 CTTTATATGTATATTTTGTGTGG - Intergenic
1194251916 X:91586591-91586613 CTCTATTTGTAGTTTTTGGGGGG - Intergenic
1196653511 X:118193328-118193350 ATTAATATGAAGATATTGGCAGG + Intergenic
1196901079 X:120383983-120384005 ATTTATATGCATATGTTGGGAGG + Intergenic
1197213189 X:123845130-123845152 ATATATATATAGATATTGGTGGG + Intergenic
1197418266 X:126203902-126203924 TTATATATGTACATATTGAGAGG - Intergenic
1197979702 X:132202491-132202513 ATTTTTTTGTAGAGATTGGGGGG - Intergenic
1198368313 X:135966294-135966316 CTTAAAATGTACATATTGGGTGG + Intronic
1199659646 X:150036085-150036107 CATTATTTGTTGATATTTGGAGG + Intergenic
1200510866 Y:4077338-4077360 CTTTATATGTATATTTTGTGTGG - Intergenic
1200570846 Y:4827829-4827851 CTCTATTTGTAGTTTTTGGGGGG - Intergenic
1201687070 Y:16716876-16716898 CTTTATATGTTGAGATTGGCTGG + Intergenic