ID: 977639674

View in Genome Browser
Species Human (GRCh38)
Location 4:99342852-99342874
Sequence TTCCTTTAGCACTTCCTGAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 592
Summary {0: 2, 1: 1, 2: 7, 3: 78, 4: 504}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977639671_977639674 -4 Left 977639671 4:99342833-99342855 CCACACCTCCATCAGTCATTTCC 0: 3
1: 0
2: 2
3: 41
4: 392
Right 977639674 4:99342852-99342874 TTCCTTTAGCACTTCCTGAATGG 0: 2
1: 1
2: 7
3: 78
4: 504
977639672_977639674 -9 Left 977639672 4:99342838-99342860 CCTCCATCAGTCATTTCCTTTAG 0: 3
1: 0
2: 3
3: 12
4: 195
Right 977639674 4:99342852-99342874 TTCCTTTAGCACTTCCTGAATGG 0: 2
1: 1
2: 7
3: 78
4: 504
977639669_977639674 22 Left 977639669 4:99342807-99342829 CCGACCGATGACTTCAAACGAAA 0: 2
1: 1
2: 0
3: 3
4: 43
Right 977639674 4:99342852-99342874 TTCCTTTAGCACTTCCTGAATGG 0: 2
1: 1
2: 7
3: 78
4: 504
977639670_977639674 18 Left 977639670 4:99342811-99342833 CCGATGACTTCAAACGAAAAATC 0: 2
1: 1
2: 1
3: 12
4: 157
Right 977639674 4:99342852-99342874 TTCCTTTAGCACTTCCTGAATGG 0: 2
1: 1
2: 7
3: 78
4: 504

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977639674 Original CRISPR TTCCTTTAGCACTTCCTGAA TGG Exonic
900247807 1:1646672-1646694 TTCCTTTAGTATTTCCTTTAAGG + Intronic
900259034 1:1713826-1713848 TTCCTTTAGTATTTCCTTTAAGG + Intronic
904071856 1:27805664-27805686 TCCCTTTAGCACTTCTTGTGAGG + Intronic
904294582 1:29510310-29510332 TTCCTTTAGCTATTCTTTAAGGG - Intergenic
905157391 1:35996836-35996858 TTCTTTTTGAATTTCCTGAACGG - Intronic
905282210 1:36856404-36856426 TTCATTTAGCAAGTCCTGAGCGG - Intronic
905839953 1:41167780-41167802 TCCCTTTAGCATTTCTTGTAAGG + Intronic
905905160 1:41612999-41613021 TTCCTTGGGCGCTTCCTGGAAGG - Intronic
906231354 1:44167408-44167430 TTCCTTAAGCATTTCTTGTAGGG + Intergenic
906676116 1:47694674-47694696 TTCCTTTGCCACTCCCTGAAAGG + Intergenic
908074397 1:60498240-60498262 TCCCTTTAGCATTTCCTGTAAGG - Intergenic
908491252 1:64646373-64646395 TTCCTTTAGCATTGCATGAGTGG + Intronic
908611815 1:65869416-65869438 TTGTTGTAGCATTTCCTGAAAGG + Intronic
908818744 1:68060182-68060204 TTCCTTTAGGAGTTCTTGTAAGG - Intergenic
909312705 1:74173770-74173792 TTCCTTCAGCACTTCTTGTAAGG + Intronic
909885115 1:80931553-80931575 TCCCTTTATCACTTCCTATAAGG - Intergenic
910156141 1:84222662-84222684 TACCTTAAGCATTTCCTGTAGGG + Intronic
910560470 1:88584296-88584318 TTCCTTTAGCATTTCTTGTAGGG - Intergenic
910709415 1:90164122-90164144 TTCCTGTAACTCTTTCTGAATGG + Intergenic
910776309 1:90879251-90879273 TCCCTTTAGCATTTCTTGTAGGG + Intergenic
911087791 1:93993643-93993665 TCCCTTGACCACTTCCTGTAGGG + Intronic
911270480 1:95795695-95795717 TTTCTTTAGCTTTTCCTCAAAGG - Intergenic
911416015 1:97575339-97575361 ATACTTTAGCTCTTCTTGAAGGG - Intronic
911538463 1:99129270-99129292 TTCCTTCAGGAGCTCCTGAAAGG + Intergenic
911565069 1:99454689-99454711 TTCCTCTAACACTGCCTAAAAGG + Intergenic
912051472 1:105534241-105534263 TTCCTTTAGCATTTCTTTCAAGG + Intergenic
912839985 1:113030765-113030787 TTCCCTAAGCACATCTTGAATGG - Intergenic
913428264 1:118759150-118759172 TTCCTTTAGCATTTCTTGAGAGG + Intergenic
913570709 1:120117330-120117352 TTCCATTAGCTATTCCTGAGAGG + Intergenic
914291516 1:146278306-146278328 TTCCATTAGCTATTCCTGAGAGG + Intergenic
914399617 1:147305799-147305821 TTCCTTCAGGAATTCCTGTAAGG - Intergenic
914552560 1:148729089-148729111 TTCCATTAGCTATTCCTGAGAGG + Intergenic
915861385 1:159448770-159448792 TTATTTTAGCATTTCTTGAATGG - Intergenic
916827294 1:168454531-168454553 TGCAGTTAGCACTTCCAGAAAGG + Intergenic
916909076 1:169325248-169325270 TGGCTCTAGCACTTCCTGATGGG - Intronic
917024466 1:170627062-170627084 TTCTTTTAACATTTCCTGCAAGG + Intergenic
917670972 1:177273236-177273258 TCCCTTTAGCTCTCTCTGAAAGG + Intronic
917768959 1:178255182-178255204 TTCCTTTAGTATTTCCTCTACGG - Intronic
917917190 1:179714215-179714237 TCCCTTTAGCATTTCTTGTAAGG + Intergenic
918225636 1:182479072-182479094 TTCCTTTAGCACTTTTTGTAAGG - Intronic
918537961 1:185595368-185595390 TTCATTTACCACTTCCTCAGGGG - Intergenic
918615962 1:186543961-186543983 TCCCTTGAGCATTTCCTAAAGGG - Intergenic
918959448 1:191254406-191254428 TTCCTTTAGCATTTCTTGTAAGG + Intergenic
919551447 1:198994125-198994147 TTCCTATTTCATTTCCTGAAAGG + Intergenic
920582975 1:207130204-207130226 TTCCTTTAGCATTTCTTGTAAGG + Intronic
920788952 1:209070496-209070518 AACCTTAATCACTTCCTGAAAGG + Intergenic
921225845 1:213018201-213018223 TTCCTTTAGCACACCCTAAGAGG + Intergenic
921392029 1:214626108-214626130 TTCCTTTAGCCCTTCTTTTAGGG + Intronic
921775219 1:219090086-219090108 TCCCTTTAGCATTTCTTGTAGGG - Intergenic
923440128 1:234009954-234009976 TCCCTTTAGCAATTCTTGTAAGG - Intronic
924211993 1:241779024-241779046 TTCTTTTAACATTTCTTGAAAGG + Intronic
924488475 1:244511710-244511732 TTCCTTAAGCATTTCTTGTAGGG + Intronic
924878423 1:248130629-248130651 TTCCTTTGGGACCTCTTGAAAGG - Intergenic
1062882664 10:990904-990926 TGCCGTTCGCACATCCTGAAGGG - Intronic
1065050963 10:21790628-21790650 TTCCTTGAGCATTTCTTGTAAGG - Intronic
1065326684 10:24555869-24555891 GTTCTTTAGCAATTCCAGAATGG - Intergenic
1065459677 10:25946247-25946269 TTCATTTAGCATTTCTTGTAGGG + Intronic
1067027092 10:42852660-42852682 TTCCTGCAGCACTTGTTGAAAGG + Intergenic
1067297748 10:44984485-44984507 TTCCTTTAGCCCTCAGTGAAGGG + Intronic
1067521608 10:47011749-47011771 CTCCTTTAGCTCTTCCTGTGTGG + Intergenic
1068054829 10:51998856-51998878 TTCCTGTGGCACTTCCAGGAGGG + Intronic
1068055455 10:52007104-52007126 TTCCTTCAGCAGCTCCTGTAAGG - Intronic
1069293541 10:66814369-66814391 TTCCTTTAGCATTTCATTTAGGG + Intronic
1070048952 10:72867940-72867962 TTCCCTTAGCACTTACTAAGGGG + Intronic
1070423319 10:76260344-76260366 TTCCTTGAGCATTTCTTGTAAGG + Intronic
1070892673 10:79953286-79953308 TTCCTTTAGCACTTCTTGCAAGG + Intronic
1071023547 10:81085806-81085828 TCCCTTTAGCATTTTGTGAATGG + Intergenic
1071340126 10:84638485-84638507 TTCCTTCAGCAGTTCTTGTAAGG - Intergenic
1071479854 10:86057006-86057028 TTCCTTCAGCACATCCATAAAGG + Intronic
1071979395 10:90988247-90988269 TTCCTGTGTCACTTCCTTAAAGG + Intergenic
1074255276 10:111796014-111796036 TCCCTTTACTTCTTCCTGAAAGG - Intergenic
1074636336 10:115322653-115322675 TTCCTTTAGTATTTCTTGTATGG + Intronic
1076775322 10:132692776-132692798 TTCTTTTAGCATTTCTTGCAAGG - Intronic
1076940456 10:133603438-133603460 TTTCTTTAGCCATTCTTGAAGGG + Intergenic
1077744221 11:4882506-4882528 TTTCTTCAGCTCTACCTGAATGG + Exonic
1078546143 11:12248406-12248428 TTACTTTCGCTCTTCCAGAAGGG + Intronic
1079426274 11:20344650-20344672 TTCCTTCAGGAGCTCCTGAAAGG - Intergenic
1079528702 11:21422206-21422228 TTCCTTTAAGATTTCCTGCAGGG - Intronic
1079649338 11:22907369-22907391 TTTCTTTAGCATTTACTGATTGG + Intergenic
1079935610 11:26612654-26612676 TTTCTTTAGCATTTCTTGTAAGG + Intronic
1080002819 11:27370295-27370317 TTCTCTTAGCACTTCCTGAAGGG - Intronic
1081416076 11:42817813-42817835 TTCTCTTAGCAATTCTTGAATGG - Intergenic
1082744683 11:56949002-56949024 TTCCTTTATTTCTTCCTGAAAGG + Intergenic
1083501502 11:63113418-63113440 TTCCTTCAGGAGTTCCTGTAAGG + Intronic
1084500898 11:69534502-69534524 TTCCTTTAGGACAGCCTGTAGGG + Intergenic
1085315813 11:75544293-75544315 TTCCTTAAGGAGTTCCTGAATGG - Intergenic
1085351481 11:75800763-75800785 TTCCTTTGTCACTTCAGGAAGGG - Exonic
1085864413 11:80272329-80272351 TTCCCTTTGCACTTCTTGTAAGG - Intergenic
1086071197 11:82801643-82801665 TCCCTTGAGCATTTCTTGAAGGG + Intergenic
1086158344 11:83693402-83693424 TTCATTTGGCCCTTCCTGAAGGG - Intronic
1086363612 11:86085814-86085836 TTCTTTTAGCATTTCTTGCAGGG + Intergenic
1087133133 11:94686401-94686423 TTTCTTTAGCATTTCTTGTAAGG - Intergenic
1087220090 11:95537454-95537476 TTCCTTCACTACTTCATGAAGGG - Intergenic
1087681466 11:101223022-101223044 TTCCTTGGGCACTTCTTGTAAGG + Intergenic
1088038357 11:105346344-105346366 TTCCTTTAGCATTTCTTGTAGGG - Intergenic
1088300272 11:108350805-108350827 TGCTTTTAGCACGACCTGAATGG - Intronic
1088382742 11:109214752-109214774 TTCCTTGAGCAATTCTTTAAGGG + Intergenic
1089677135 11:120097688-120097710 TCCCATTACCCCTTCCTGAAGGG + Intergenic
1090179435 11:124683213-124683235 TTCCTTGAACACTTCTTGTAGGG - Intronic
1091051256 11:132374656-132374678 TCCCTTTAGCATTTCTTGTAGGG - Intergenic
1091125850 11:133095943-133095965 TTCCTTTAATATTTCTTGAAAGG - Intronic
1092461219 12:8688000-8688022 TTTCATAAGCTCTTCCTGAATGG - Intronic
1093694546 12:22145300-22145322 TTCCTTCAGCACTTCTTGTAGGG - Intronic
1094609184 12:31977042-31977064 TTACTTTTTCACTTCCTTAATGG + Intronic
1094821135 12:34226173-34226195 TCCCTTTAGCATTTCTTGTAAGG + Intergenic
1095501499 12:42845002-42845024 TCCCTTTAGCATTTCTTGTAGGG + Intergenic
1097499576 12:60385675-60385697 TTCCTTTAGTATTTCTTGTAAGG + Intergenic
1098150528 12:67541807-67541829 TTCCTTCAGCACATGCTCAAGGG + Intergenic
1098624476 12:72645951-72645973 TTCCTTTAGCATTTCTTTCAAGG - Intronic
1098644219 12:72878914-72878936 TCCCTTGAGCATTTCTTGAAAGG + Intergenic
1099224585 12:79954654-79954676 TTCCTTTAGCACTTTTTGTAAGG + Intergenic
1100101862 12:91118049-91118071 TTCATTTTGGACTTCCCGAAAGG + Intergenic
1101195669 12:102379450-102379472 TTCCATTACCATTTCCTGGATGG - Intergenic
1101869304 12:108550211-108550233 TTCCTTTAGCTATTCTTCAAGGG - Intronic
1102655493 12:114479616-114479638 TTCCTTTTGAATTTCCTGTAAGG + Intergenic
1104101333 12:125614836-125614858 TTCCTTTACCATTTCTTGTAAGG + Intronic
1105383756 13:19911476-19911498 TTCTTTTAGCCTTTCCCGAAGGG + Intergenic
1105856225 13:24374673-24374695 TTCCTTTAGTATTTCTTGTAAGG - Intergenic
1106161960 13:27209374-27209396 TCCTTTTAGCATTTCCTGTAGGG - Intergenic
1107160702 13:37223954-37223976 TTCTTTTAGCATTTCTTGCAAGG + Intergenic
1108833070 13:54503439-54503461 TACCTTTAGCATTTCTTGTAGGG + Intergenic
1108924187 13:55717872-55717894 TTCCTTGAGCATTTCTTGTAGGG + Intergenic
1109171422 13:59102157-59102179 TTCCTTTTACACTCCCTAAAAGG - Intergenic
1109373432 13:61456451-61456473 TTCCTTTAGCAATTCTGGTATGG + Intergenic
1111594991 13:90400040-90400062 TCCCTTTAGGAATTTCTGAAAGG + Intergenic
1112915921 13:104550321-104550343 TTCCCTTTGCTCTTCCTGATTGG - Intergenic
1113873224 13:113577186-113577208 GTCCTTTAGCATTTCCTGCAGGG - Intergenic
1114561936 14:23599328-23599350 TCCCTTTAGCATTTCTTGTAAGG + Intergenic
1114762004 14:25326417-25326439 TTTCTTTGACATTTCCTGAAAGG + Intergenic
1115056401 14:29133231-29133253 TTTCTTTAGCCCTTCCTATATGG + Intergenic
1115382293 14:32754652-32754674 TTCCTTTAGCATTTCTTGTAAGG + Intronic
1115672717 14:35632981-35633003 TTCCCTTTGGACTTCCTCAAAGG - Intronic
1116139713 14:40975876-40975898 TTCCTTTACAACTTGCTGATAGG + Intergenic
1116497587 14:45581385-45581407 TCCCTTTAGCATTTCTTGTAGGG + Intergenic
1116920650 14:50569706-50569728 TACCATTAGCATTTCTTGAAAGG + Intronic
1116930490 14:50686228-50686250 TCCCTTTAGCATTTCTTGTAGGG + Intergenic
1119117577 14:72040285-72040307 TTCCATTAGCATTTCCTGTAAGG + Intronic
1119940185 14:78632315-78632337 TTCCTTTAGCAGCTGGTGAAGGG + Intronic
1120122799 14:80701977-80701999 CTCCCCTGGCACTTCCTGAATGG + Intronic
1120829788 14:88987673-88987695 TTCCTTAACCACTTCCTTAAAGG - Intergenic
1121672338 14:95721860-95721882 TCCCTTTAGCATTTCTTGTAAGG + Intergenic
1122304744 14:100756025-100756047 TTCCTTTAGCATTTTTTGTAAGG - Intergenic
1122698332 14:103569519-103569541 CTCCTTTAACATTTCCTGATGGG + Intronic
1122845062 14:104489620-104489642 TTCCTTTAGTATTTCTTGTAAGG - Intronic
1123426717 15:20177181-20177203 TTCCTGCAGCACTTGTTGAAAGG + Intergenic
1123535948 15:21183708-21183730 TTCCTGCAGCACTTGCTGAAAGG + Intergenic
1123773445 15:23553562-23553584 TCCCTTTAGCATTTCCTGTTAGG + Intergenic
1124091032 15:26600711-26600733 TCCCTGTAGCAATTCCTGTAAGG - Intronic
1124152537 15:27194421-27194443 TTCCTTTAGCAACTCCTTAAGGG + Intronic
1124352402 15:28967080-28967102 TTTCTTTAGCCCTTCTTTAAAGG + Intronic
1125432652 15:39610958-39610980 TCCCTTTAGCATTTCCTGTTAGG - Intronic
1126263724 15:46727738-46727760 TCCCTTTAGCAATTCCTGTAAGG + Intergenic
1126998948 15:54479811-54479833 TTCCTTAAGCATTTCTTGTAAGG + Intronic
1127776474 15:62267907-62267929 TCCCTTTAGGAGTTACTGAAAGG - Intergenic
1128175723 15:65554035-65554057 CTCCTTTAGCACATCCCAAATGG - Intronic
1128257335 15:66207532-66207554 TTCCTTTAGTAGTTCTTGTAGGG - Intronic
1128380056 15:67105854-67105876 TTGCTTGAGCATGTCCTGAATGG + Intronic
1128757170 15:70190984-70191006 TTCCATCAGCAGTTCCTAAATGG - Intergenic
1129564005 15:76602277-76602299 TTCTTTTAACATTTCCTGCAAGG + Intronic
1129831904 15:78676203-78676225 TTCCTTGAGCACTCCATGCAAGG + Intronic
1130142369 15:81238777-81238799 TTCCTTTAGCCATTCTTTAAGGG + Intronic
1131903754 15:97118012-97118034 TCCCTTTAGCATTTCTTGTAGGG - Intergenic
1133342907 16:5048611-5048633 TCCCTTGAGCACTTCTTGTAAGG - Intronic
1133843620 16:9433682-9433704 TTCTTTAAGCACTTCTTGTAAGG + Intergenic
1133900932 16:9973896-9973918 TTCCTTTAGCATTTCTTGAAGGG - Intronic
1133903441 16:9998885-9998907 CTCCTTCAGGACTTCCTGGATGG + Intronic
1134328437 16:13228394-13228416 TTTCTTTAGAACTTTCTGAGGGG + Intronic
1135068094 16:19328355-19328377 TTCTTTTAGCATTTCTTGCAGGG + Intergenic
1135229145 16:20688750-20688772 TTCCTTTAGCATTTCTTGTAGGG - Intronic
1135477915 16:22794133-22794155 TGCCTTCAGAACATCCTGAAAGG + Intergenic
1136857533 16:33672324-33672346 TTCCTGCAGCACTTGTTGAAAGG - Intergenic
1137266478 16:46873173-46873195 TCCCTTTAGCATTTCTTGTAGGG - Intergenic
1137324801 16:47423597-47423619 TTCCTTTAGGAGCTCCTGTAAGG + Intronic
1138753414 16:59452641-59452663 TCCCTTTAGCATTTCTTGTAAGG + Intergenic
1138994801 16:62436477-62436499 TCCCTTTAGCATTTCCTGTAGGG - Intergenic
1139523208 16:67497176-67497198 TGCCTTCAGCATGTCCTGAATGG + Intergenic
1140563767 16:76015327-76015349 TTCCTTTAACAATTCTTGTAAGG + Intergenic
1141003756 16:80333223-80333245 TACCTTCAGCACTTACTGATGGG + Intergenic
1203119106 16_KI270728v1_random:1520809-1520831 TTCCTGCAGCACTTGTTGAAAGG - Intergenic
1144112252 17:12047037-12047059 CTCCTCTATCAGTTCCTGAAAGG - Intronic
1146820151 17:35978250-35978272 TTCCTTCAGAAGTTCCTGAGTGG - Exonic
1147901598 17:43789862-43789884 TTCCTTTAGCCATTCTTTAAGGG + Intergenic
1149092354 17:52798939-52798961 TCCCTTTAGCATTTCTTGTAAGG - Intergenic
1150026935 17:61686152-61686174 TTTCTTTAGGACTTTCTAAATGG - Exonic
1150027329 17:61690196-61690218 TTCCTTTAGCATATCTTGTAAGG - Intronic
1150494898 17:65599940-65599962 TTCTCTGAGCACCTCCTGAAGGG + Intronic
1150881689 17:69036507-69036529 TTCCTTTAGGAGCTCTTGAAAGG - Intronic
1152369234 17:79875488-79875510 TTCCTTTAGCTGTTCTTTAAGGG + Intergenic
1153163026 18:2230145-2230167 TCCCTTTAGCACTTCTTGTTTGG - Intergenic
1153379350 18:4419406-4419428 TTCCTTTACCACTTTTTGAAGGG - Intronic
1153943687 18:9998982-9999004 TCTCTTTAGCATTTCCTGTAAGG - Intergenic
1155766230 18:29636773-29636795 TTCCTTTAGCATTTCTGGTAAGG + Intergenic
1156165939 18:34421246-34421268 TTCCTTTATTGATTCCTGAATGG + Intergenic
1156798224 18:41075126-41075148 TTCCTTTAGGAACTACTGAAGGG - Intergenic
1157214841 18:45774257-45774279 TTCCTTTAGCTCTCCCTAAATGG + Intergenic
1158952954 18:62512854-62512876 TTCCTTTAGTATTTCTTGTAAGG - Intergenic
1158971431 18:62671390-62671412 TCCCTTTAGCATTTCCTACAGGG + Intergenic
1159217940 18:65421008-65421030 TTCCTCTAGCATTTCTTGCAAGG - Intergenic
1159260674 18:66007904-66007926 TTCCTTTAGCGGTTCTTGTAGGG - Intergenic
1160415627 18:78708362-78708384 TTCCTTTAGTGATTCCTTAAGGG + Intergenic
1160558706 18:79742485-79742507 TTCCTTTAGAACTTCTTGTAAGG - Intronic
1161317944 19:3626997-3627019 TGCCTCCAGCACTGCCTGAAAGG - Intergenic
1165616019 19:37201180-37201202 TTCCTTTGGCAATTCCAGATAGG - Intronic
1166087349 19:40485915-40485937 TTTCTTTTGCACTTCCCTAATGG - Intronic
1168396553 19:56053530-56053552 TTCCTTTATTCCTTCCTGACGGG - Intronic
925554026 2:5109183-5109205 TTTCTTTAGCATTTCTTGTAAGG + Intergenic
925758568 2:7160355-7160377 TTCTTTTACCACTTCTTGCAAGG + Intergenic
926215775 2:10904415-10904437 TCCATTTAGAATTTCCTGAAGGG - Intergenic
926377231 2:12244047-12244069 TTCCTATAGCCATTCCGGAAAGG - Intergenic
926478834 2:13360984-13361006 TTCTTTTAGCATTTCTTGTAGGG - Intergenic
926558062 2:14382704-14382726 CTCCTTTAGCACTTACTCACTGG - Intergenic
927258144 2:21058906-21058928 TTGCCTTTGAACTTCCTGAATGG + Intergenic
928479957 2:31673312-31673334 TTCTTTTAGCATTTCTTGTAGGG + Intergenic
930145630 2:48000631-48000653 TTCTTTTAGCATTTCTTGTAGGG - Intergenic
930430073 2:51264589-51264611 TTCCTTTAGCAGCTCCAGGAAGG + Intergenic
931505339 2:62920458-62920480 TCCATTTAGCACTTCTTGCAGGG - Intronic
932546775 2:72719767-72719789 TTCCTTTAGTATTTCTTGTAAGG - Intronic
933409681 2:81909886-81909908 CTCCTTTTGCACATCCTGCAAGG - Intergenic
933474180 2:82767742-82767764 TCCCTTTAGCACTTCTTGTAAGG - Intergenic
934037769 2:88103059-88103081 CTCCTTCACCACTTCCTGAGAGG - Exonic
935072121 2:99704280-99704302 TTCCTTTAGCTATTCTTTAAGGG + Intronic
935181805 2:100697744-100697766 CTCCTTTAGTATTTCTTGAAAGG - Intergenic
935610486 2:105018953-105018975 TCCTTTTAGCAGTTCTTGAAGGG - Intergenic
935884457 2:107601301-107601323 TTCCTTTAGTATTTCTTGTAAGG + Intergenic
936292978 2:111241399-111241421 TTCCTTTAGTATTTCCTGAAGGG + Intergenic
936865852 2:117075975-117075997 TTCATTTAGTACTTCATTAATGG + Intergenic
936908533 2:117566061-117566083 TTCCTTTAGGACATCTTGTAAGG - Intergenic
936942253 2:117897119-117897141 TTCCTTTAACACTTCTTTCAAGG + Intergenic
938177683 2:129151235-129151257 TTCCTCTAGCATTTCTTGTAGGG + Intergenic
938255151 2:129852572-129852594 TCCCTTTAGAATTTCCTGTAGGG - Intergenic
938384717 2:130856467-130856489 TTCCTTTAGTATTTCTTGCAAGG - Intronic
939573760 2:143871278-143871300 TTCCTTTAGCATTTCTTGTAGGG - Intergenic
939793649 2:146614162-146614184 TTTCTTTAGCATTTCTTGTAAGG + Intergenic
940757647 2:157701308-157701330 TTCCTTGAGCATTTCTTGTAAGG - Intergenic
941256570 2:163239743-163239765 TCCCTTTAGCATTTCTTGTAAGG + Intergenic
943822460 2:192343888-192343910 TTCTTTTAACACCTCCTGTAAGG + Intergenic
944346917 2:198678894-198678916 TCCCTTTAACATTTCCTGTATGG - Intergenic
944604602 2:201340770-201340792 TTCCTTTTGCAATTTCTGTAAGG + Intronic
945631256 2:212280413-212280435 ATTCTTTAACACTTGCTGAAAGG + Intronic
947140655 2:227016858-227016880 TTCCTTTCTCACCTACTGAATGG - Intronic
947248207 2:228073547-228073569 GTCTTTTAGCCCTTCCTGAGAGG - Intronic
947532472 2:230921183-230921205 TTTCTTTTGCATTTCCTGCATGG - Intronic
947787518 2:232836979-232837001 TTCCTCTAACATTTGCTGAAGGG + Intronic
947802304 2:232937535-232937557 TTCTGTTAGCACTGCCTGCACGG + Intronic
948625869 2:239267476-239267498 TGCCTTCAGCACGTCCTCAAGGG - Intronic
1169509510 20:6248617-6248639 TTCTTTTAGTATTTCCTGAAAGG + Intergenic
1170132800 20:13040745-13040767 TCCCTTTAGTACTTCTTGAAAGG + Intronic
1170161336 20:13314608-13314630 TTCTTTTAGCATTTCTTGCAAGG - Intergenic
1170183564 20:13561189-13561211 TTCCTTCAGCATTTCTTGCAGGG - Intronic
1170718476 20:18852953-18852975 TCCCTTTAGCATTTCTTGCATGG + Intergenic
1171284986 20:23929625-23929647 TCCTTTTAGCAATTCCTGACTGG - Intergenic
1172172236 20:32944623-32944645 TCCCTTTAGCATTTCTTTAAAGG + Intronic
1173126767 20:40343694-40343716 TTACTTTAGCATTTCTTGTAAGG - Intergenic
1173772961 20:45679703-45679725 TCTCTTTAGCACTTCTTGTAAGG + Intergenic
1173801769 20:45898643-45898665 TTCCCGCAGCAGTTCCTGAATGG + Exonic
1174908873 20:54584874-54584896 TTCCTTTAGCATTTCTTATAAGG + Intronic
1175324211 20:58111188-58111210 CTCTTTGAGCACTACCTGAAGGG + Intergenic
1175555016 20:59845438-59845460 TTCCTTTAGGACTTGGTGAAAGG + Intronic
1176341005 21:5695980-5696002 TTCCTTTAGCATTCCCTGTTTGG - Intergenic
1176360577 21:5993550-5993572 TTCCTTGAGCATTTCTTGTAAGG + Intergenic
1176473259 21:7128133-7128155 TTCCTTTAGCATTCCCTGTTTGG - Intergenic
1176503822 21:7628476-7628498 TTCCTTTAGCATTCCCTGTTTGG + Intergenic
1176926424 21:14755089-14755111 TCCCTTTAGAACTTCTTGTAAGG - Intergenic
1176989875 21:15482451-15482473 TTTCTTTAGTACTTTCAGAAAGG - Intergenic
1177183973 21:17773910-17773932 TTCCTTTAGGAGCTCCTGTAAGG + Intergenic
1177399975 21:20591151-20591173 TTCCTTTAGAATTTCTTGTAAGG + Intergenic
1179762941 21:43545000-43545022 TTCCTTGAGCATTTCTTGTAAGG - Intronic
1180137702 21:45871840-45871862 TTCCTTAAGCAGCTCCTGGAAGG + Intronic
1181654944 22:24288970-24288992 TTCATTTTGCACTTCATTAATGG - Intronic
1182398846 22:30058414-30058436 TTCCTTTAGCATTTCTTATAAGG - Intergenic
1182672977 22:32013278-32013300 TTTATTTAGCACTTCCTATAAGG + Intergenic
1182765435 22:32754732-32754754 CTCCTTCGGCACTTGCTGAAAGG + Intronic
1183943182 22:41308198-41308220 TTCCTTGAGCACTTCCTGTGAGG + Intronic
1185136426 22:49075943-49075965 TGCCTCTAGCACTACCTGAATGG - Intergenic
1203240271 22_KI270733v1_random:10438-10460 TTCCTTTAGCATTCCCTGTTTGG - Intergenic
949216293 3:1572585-1572607 TTTCTTTAACATTTCCTCAAGGG - Intergenic
949218886 3:1605813-1605835 TTCCTTTAGTATTTCCTGTAAGG + Intergenic
949631308 3:5929688-5929710 TTCTTTTTGCAATTCCTGTAAGG + Intergenic
949914796 3:8951469-8951491 TTCTTTTAGCATTTCTTGCAAGG - Intronic
951143446 3:19196499-19196521 TTCCTTTAGCACATCCTTCCTGG + Intronic
951175089 3:19589882-19589904 TCCCATTAGCACTTCATGGAAGG + Intergenic
951269941 3:20611954-20611976 TCCCTTCAGTACTTTCTGAAAGG - Intergenic
951432660 3:22626670-22626692 TTCCTTTAGGAGTTCTTGTAAGG + Intergenic
951692255 3:25408647-25408669 TTCCCTTAGCAATTCTTTAATGG - Intronic
952272022 3:31842483-31842505 TTTCTTTTGCATTTCCTGTAAGG - Intronic
952549362 3:34459041-34459063 TCCCTTTAGCATTTCCTGTAAGG + Intergenic
952584186 3:34871481-34871503 TTCCTTGACCACATCCAGAATGG - Intergenic
953193044 3:40707230-40707252 TTCGTTTAACATTTCTTGAAAGG + Intergenic
953997314 3:47529968-47529990 TTCCTTTAGTATTTCTTGTAAGG - Intergenic
954093590 3:48304253-48304275 TCCCTTTAGTATTTCCTGCAGGG + Intergenic
954312860 3:49783763-49783785 TTCCTTGGGCAGTTCTTGAAAGG - Intronic
954467814 3:50667076-50667098 TTCATTTTGCACTTGCTTAAAGG - Intergenic
954963690 3:54591112-54591134 TTCATTTAGGACTTACTTAATGG + Intronic
955528470 3:59846732-59846754 TCCCTTTAGCATTTCTTGAAGGG + Intronic
955837972 3:63078684-63078706 TTCTTTTAGCTCTGCCTGCATGG + Intergenic
955866289 3:63388039-63388061 TGCCTTTAGAACTCCCTGCAGGG - Intronic
956047453 3:65210790-65210812 TTCCATTAGTATTTCCTGTAAGG - Intergenic
956051364 3:65251803-65251825 TTTCTGTAGCAATCCCTGAAAGG - Intergenic
956065943 3:65397335-65397357 TTCCTTTAGCATCTCTTGCAGGG + Intronic
956392646 3:68789908-68789930 ATCCTTTAGCATTTCTTGTAGGG - Intronic
957369436 3:79273091-79273113 TTCCTTTAGCATTTCTTATAAGG - Intronic
957678089 3:83395948-83395970 TCTCTTTAGCATTTCCTGTAGGG - Intergenic
959147206 3:102563444-102563466 TCTCTTTAGCATTTCTTGAAAGG + Intergenic
959328543 3:104971812-104971834 TTCCTTTAGCATTTCTTATAGGG + Intergenic
959402433 3:105919878-105919900 TCCCTTTAGCAATTACTGTAAGG + Intergenic
959855166 3:111145341-111145363 TTCGGTTACCACTTCATGAAAGG - Intronic
959987545 3:112592573-112592595 TTCCTTTAGCACTTCTTACAGGG + Intergenic
960481445 3:118196135-118196157 TTCCTTTATCACTTTTTCAAAGG + Intergenic
960598235 3:119427754-119427776 TCCATTTAGCAATTCCTGCAAGG + Intergenic
960749774 3:120935526-120935548 TTCTTTTAGCATTTCTTGCAAGG + Intronic
960850708 3:122050800-122050822 TCTCTTTAGCATTTCTTGAAAGG + Intergenic
961328058 3:126122168-126122190 TTCTTTTAGTATTTCCTGTAAGG - Intronic
962121647 3:132566753-132566775 TTCCTTTAACATTTCCTTTAGGG - Intronic
962563512 3:136633396-136633418 TCCCTTTAGCATTTCTTGTAGGG - Intronic
962853024 3:139322149-139322171 TTCCTCTAGCAGATCCTGCAGGG + Intronic
963330413 3:143909117-143909139 TTACTTTAGCATTTCTTGCAAGG + Intergenic
963459864 3:145597846-145597868 TTCCTTTAGCATTTCTTGTAAGG + Intergenic
964015027 3:151934414-151934436 TTCCTTTTGTACCTTCTGAAAGG - Intergenic
964225243 3:154391046-154391068 TTCCTTTAGCATTTCTTGTTAGG - Intronic
964323328 3:155520428-155520450 CTCCTTTAGAACTTGCTGGAAGG + Intronic
965221011 3:165925430-165925452 TTCCTTTAGAACCTCCACAAAGG + Intergenic
965294546 3:166926893-166926915 CTCCTCTAAAACTTCCTGAAAGG - Intergenic
965327683 3:167328000-167328022 TTGACTTAACACTTCCTGAAAGG + Exonic
965828526 3:172754973-172754995 TTCCTTTACCACTTTATAAATGG + Intronic
965842823 3:172926890-172926912 TTCGTTTAACACTGCCAGAAAGG + Intronic
966481721 3:180416717-180416739 TTACTTTAACACTTCCAGAGTGG - Intergenic
966895066 3:184438580-184438602 TTCCTTTAGTATTTCTTGTAAGG + Intronic
966998186 3:185305652-185305674 TTCCTTTCGCATTTCTTGTAAGG + Intronic
967551304 3:190798688-190798710 TTCCTTTAGCATTTCTTGTAGGG - Intergenic
967636807 3:191810824-191810846 TTCCTTTAGCATTTCTGGTAGGG - Intergenic
967654356 3:192028802-192028824 TTCCTTTAACATTTCTTGCAAGG - Intergenic
968543664 4:1183329-1183351 TTCCTTAAGCATTTCTTGCAGGG - Intronic
968706136 4:2078896-2078918 TTCCTTTATCAATTCCACAAGGG + Intronic
968709616 4:2103950-2103972 TCCCTTGAGCATTTCTTGAAGGG - Intronic
969434460 4:7179234-7179256 TTCCTTTGGTATTTCTTGAAAGG + Intergenic
969507366 4:7596676-7596698 TTCCTTTAGCACCTCCTGGCAGG + Intronic
970048958 4:11889431-11889453 TTCCTTTAGTATTTCCTCTAAGG - Intergenic
970605249 4:17674011-17674033 TTCCTTTAGCATTTCTTGTAAGG - Intronic
970783244 4:19765611-19765633 TTTCTTAAGCACTTCTTGTAAGG + Intergenic
971090653 4:23341285-23341307 TTGCTTTAACATTTCCTTAATGG - Intergenic
971102538 4:23483811-23483833 TTCCTTTAGCCTTTCCTCAGAGG - Intergenic
971636785 4:29071300-29071322 TTCCATTAGCATTTCTTGTAAGG + Intergenic
971914328 4:32849025-32849047 TCCCTTTAGCATTTCTTGTAGGG + Intergenic
972207981 4:36800655-36800677 TTCCTTTAGCATTTCTTGTAGGG - Intergenic
973107248 4:46355590-46355612 TCACTTTAGCACTTCCTGCAGGG + Intronic
973222175 4:47739528-47739550 TTCCTTTAGTACTTCTTACAGGG - Intronic
974573945 4:63691717-63691739 ATCTTTTAGTATTTCCTGAAGGG - Intergenic
975051779 4:69874168-69874190 TACCTTTAATACTTTCTGAAAGG + Intergenic
975094290 4:70439320-70439342 TTCCTTTAGCACCTTCTAAGTGG + Intronic
975215499 4:71749206-71749228 CTACTTTAGCAATTACTGAAAGG + Intronic
975524442 4:75333187-75333209 TTCCTTTAGGAGTTCTTGTAAGG - Intergenic
975899826 4:79138845-79138867 TTCTTTTAGGACTTCTTGTAGGG + Intergenic
976329970 4:83819631-83819653 TCCCTTTAGCACTTCTTATAAGG + Intergenic
976347223 4:84018400-84018422 TTCCCTTATCTCTTCTTGAAAGG - Intergenic
976631644 4:87243763-87243785 TCCCTTTAGCATTTCTTGTAGGG - Intergenic
977634568 4:99282403-99282425 TTCCTTTAGCACCTCCTGGATGG + Exonic
977637261 4:99313878-99313900 TTCCTTTAGCACTTCCTGAATGG + Exonic
977639674 4:99342852-99342874 TTCCTTTAGCACTTCCTGAATGG + Exonic
978243023 4:106539276-106539298 TTCCTTTAGGACCTCTTGAAGGG + Intergenic
978738493 4:112111542-112111564 TTCCCACAGCATTTCCTGAAGGG + Intergenic
978934361 4:114357453-114357475 TCCCTTTAGCACTTTTTGTAAGG + Intergenic
979365028 4:119812060-119812082 TTCCTTTAGCATTTCTTGCAAGG + Intergenic
979365910 4:119823044-119823066 TCCCTTTAGCATTTCTTGTAGGG - Intergenic
980017291 4:127665496-127665518 TTCTTTTACCTCTTCCTGAAAGG + Intronic
980197612 4:129611360-129611382 TTCCTTTTACATTTCCTGATGGG - Intergenic
980624524 4:135357241-135357263 TCTCCTTAGCACTTCCAGAAAGG - Intergenic
980894923 4:138852973-138852995 TTCCCCTAGCACTTCCTAACAGG + Intergenic
980956956 4:139438894-139438916 TTCATTTAGCATTTCTTGTAGGG + Intergenic
981296880 4:143142338-143142360 TTCCTTTAGGAGCTCCTGTAAGG - Intergenic
981455949 4:144953597-144953619 TTCCATTAGCATTTCTTGTAAGG - Intergenic
981929588 4:150175344-150175366 TTTCTTCAGTACTTCCTAAATGG - Intronic
982799757 4:159689792-159689814 TTCCTTTAACATTTCTTGCAGGG - Intergenic
983628124 4:169823928-169823950 TTCCATCAGCACTTGCTGACCGG + Intergenic
983665609 4:170178646-170178668 TTCCTTTAGCATTTCTTGTAGGG + Intergenic
984460030 4:180022813-180022835 TTCCTTAAGCCGTTCTTGAAGGG - Intergenic
984770102 4:183429875-183429897 TTCCTTGACCTCTTCCTAAATGG - Intergenic
985428329 4:189853445-189853467 TCCCTTTAGCAATTCCTGTAAGG + Intergenic
985860356 5:2465851-2465873 TTCCTCTAACATTTCCAGAAAGG - Intergenic
985874036 5:2581766-2581788 CTCCTTTACCACCTCCTGGAAGG - Intergenic
985969018 5:3360749-3360771 TTCCTCTGGCCCTTCCAGAAGGG + Intergenic
986861758 5:11934650-11934672 TCCCTTTAGCATTTCCTGTAAGG - Intergenic
986915944 5:12621208-12621230 TCCTTTTAGCATTTCCTGTAGGG + Intergenic
987233426 5:15918541-15918563 TTCCTTTAGCTCTTCTAGAAGGG - Intronic
987672162 5:21023946-21023968 TCCCTGTAGCACTTCTTGTAGGG - Intergenic
987713549 5:21535496-21535518 TCCCATTAGCATTTCTTGAAAGG - Intergenic
987723440 5:21666717-21666739 TTCTTTTAGCACATCTTGCAGGG + Intergenic
988037977 5:25852181-25852203 TTCCTTTTGTACTTGGTGAATGG - Intergenic
988310765 5:29554684-29554706 TTCCTTGAGCATTTCTTGTAAGG + Intergenic
988577650 5:32443584-32443606 TTCCTTTAGTTTTTCCTGCAAGG - Intronic
989302091 5:39907039-39907061 TTACTTAATCACTTCTTGAATGG - Intergenic
989443232 5:41496673-41496695 TCCCTTTAGCATTTCTTGTAAGG - Intronic
989684849 5:44073532-44073554 TTCCTATATTACTTCCAGAAAGG + Intergenic
990108052 5:52288814-52288836 TTCCTCTAGAACTTCCAGAAAGG + Intergenic
990244046 5:53844974-53844996 TTCTTTTAACATTTCCTGTAAGG - Intergenic
990733965 5:58839778-58839800 TTCCTTGAACACTTCTTGTAAGG + Intronic
991176493 5:63694013-63694035 TTTCTTTAGCGATTCTTGAATGG - Intergenic
992926584 5:81593818-81593840 TTCCTTTAGGAGTTCCTTTAGGG - Intronic
992934721 5:81689684-81689706 TCCCTTTAGCATTTCTTGTAGGG - Intronic
993453109 5:88096665-88096687 TTGTTTTAGCACTTCCAAAAAGG + Intergenic
993547177 5:89227872-89227894 ACCCTTTAGCATTTCCTGTAAGG + Intergenic
993927753 5:93891964-93891986 GTGCTTCAGCACTTTCTGAAAGG - Intronic
994149345 5:96431061-96431083 TTCCTTGAGCAGCTACTGAAAGG - Intronic
994500088 5:100564461-100564483 TTCTTTTGCCACTTTCTGAAAGG - Intronic
994888892 5:105603483-105603505 TCCTTTTAGCACTTCTTGTAGGG + Intergenic
995000720 5:107124696-107124718 TTCTTTAAGCACTTACTAAAAGG + Intergenic
995319237 5:110813191-110813213 TTTCTTTAGCATTTCTTGTAGGG - Intergenic
995466811 5:112458516-112458538 TCCCTTTAGCATTTCTTGTAGGG - Intergenic
995649488 5:114353607-114353629 TTTCTTTAGCATTTCTGGAAAGG + Intergenic
996323879 5:122250962-122250984 TTCCTTTAGGAGTTCTTGTAAGG + Intergenic
996781813 5:127195074-127195096 TCCCTTTAGCATTTCTTGTAAGG - Intergenic
997081060 5:130738710-130738732 TTCCTTTAGTACTTCTTGTAAGG - Intergenic
997145114 5:131424383-131424405 TTCCTTCAGCATTACCTTAAAGG - Intronic
997174244 5:131757592-131757614 TTCCTTTTGCCCTTCCAGTAGGG - Intronic
997245507 5:132345077-132345099 AACCTTTAGAACTTCCTGAGTGG - Intergenic
997785591 5:136709849-136709871 TTCCTCCATCACTTCCTAAAAGG + Intergenic
997865947 5:137462945-137462967 ATCCTTTTCCACTCCCTGAATGG - Intronic
998752199 5:145334641-145334663 TTCCTTCAGCACTTTTTGTAAGG + Intergenic
999355170 5:150921488-150921510 TTTCTTTAGCCATTCTTGAAGGG - Intergenic
999549070 5:152664102-152664124 TTCCTTTAGCATTTCTTGTAAGG - Intergenic
999579590 5:153021863-153021885 TTCCTTTAGTAGTTCTTGTAAGG - Intergenic
999687172 5:154113383-154113405 TTCCCCTAGAACTTCCAGAAGGG + Intronic
1000749551 5:165076676-165076698 TTCCTTTAGTAGTTTCTGTAAGG + Intergenic
1000777407 5:165437995-165438017 TTTCTTTAGCATTTCTTGTAAGG + Intergenic
1000877077 5:166653626-166653648 TTACTTTAGCATTTCTTGCAGGG + Intergenic
1003079715 6:3011910-3011932 TCCCTTTAGCATTTCTTGTAAGG - Intronic
1003215942 6:4112192-4112214 TTCCTTTAACATTTCTTGTAGGG + Intronic
1003462164 6:6339642-6339664 TTCCTTTAGGAATTCCTGGTGGG + Intergenic
1004749420 6:18546143-18546165 TCCCTTTAGCATTTCTTGCAGGG - Intergenic
1006571727 6:35010995-35011017 TTGCTCTAGCACTTACTGGATGG + Intronic
1006890655 6:37424856-37424878 TTCCTTGAGCATTTCTTGAAGGG + Intergenic
1007478977 6:42137631-42137653 TCCCTTTAGGACTCCCTGCAGGG - Intronic
1007726135 6:43916730-43916752 TTCCTTGAACACTTCCAAAATGG + Intergenic
1007920194 6:45601083-45601105 TTCCTTTAATATTTCCTGTAAGG - Intronic
1008159251 6:48057343-48057365 TTCCTTTACAACTTCCTTCAAGG + Intronic
1008219731 6:48841338-48841360 TTCCCTTACCATTTGCTGAAAGG + Intergenic
1008789680 6:55215410-55215432 TTCATTTAGCATTTCTTGTAAGG - Intronic
1008858232 6:56116532-56116554 TGCCTTTAGCATTTCTTGTATGG - Intronic
1009003170 6:57746401-57746423 TCCCATTAGCATTTCTTGAAAGG + Intergenic
1009034788 6:58103548-58103570 TTCTTTTAACATTTCTTGAAGGG - Intergenic
1009467662 6:63992074-63992096 TTCCTTTAGCATTTCTTGTAAGG - Intronic
1009783384 6:68298739-68298761 TCCTTTTAGCATTTCCTGTAGGG - Intergenic
1009894272 6:69727802-69727824 TTCCTTTAACATTTCCTTATAGG + Intronic
1010488495 6:76446192-76446214 TTCCTTTAGCAATTCCTGTAAGG + Intergenic
1010821135 6:80417502-80417524 TTCCTTCAGGACTTCTTGTAAGG + Intergenic
1011079288 6:83472016-83472038 TTGCTCTAGCACTTCCTCACAGG + Intergenic
1011205370 6:84889094-84889116 TCCCCATAGCAATTCCTGAAGGG - Intergenic
1011857783 6:91716401-91716423 TTTCTTTAGCAGTTCCGAAAAGG + Intergenic
1012443777 6:99288105-99288127 TTTCTCTATTACTTCCTGAAAGG - Intronic
1012795541 6:103755627-103755649 TCCCTTTAGCATTTCTTGTAAGG - Intergenic
1013653703 6:112223769-112223791 TTCCTTTTGCTCTTCCTCACAGG + Intronic
1014537025 6:122626594-122626616 TTCCTTTTGCTCTTCCTGGAAGG - Intronic
1014583248 6:123163758-123163780 TCCCTTTAGCATTTCCTGTAGGG - Intergenic
1015038296 6:128685060-128685082 TCCTTTTAGCACTTCTTGCATGG + Intergenic
1016860437 6:148713018-148713040 TTCCTTGAGCACTTCGCAAAAGG - Intergenic
1017536738 6:155354937-155354959 TCCCTTTAGCAATTCCTGTAAGG - Intergenic
1018394822 6:163370135-163370157 TTCCTCTTCCACTTCCTGTATGG + Intergenic
1018866570 6:167751139-167751161 TTCCCAAAGCACTTCCTGAAAGG - Intergenic
1019036101 6:169060811-169060833 TCCCTTAAGCATTTCCTGTAAGG + Intergenic
1019073557 6:169369111-169369133 TTCATTTAACACTTACTGAAGGG - Intergenic
1021166791 7:17352615-17352637 TTCCTTCAGGACTTCTTGTAAGG + Intergenic
1021323587 7:19240554-19240576 TCCTTTTAGCACTTCTTGTAGGG + Intergenic
1021521792 7:21545954-21545976 TTAATTTAGAACGTCCTGAATGG + Intronic
1021771932 7:24011914-24011936 TCCCTTTAGCATTTCTTGTAAGG - Intergenic
1022578112 7:31518240-31518262 TTCCTTTAGAGCTTCCAGGAAGG + Intronic
1022758728 7:33324631-33324653 TCCCTTTAGCATTTCTTGTAGGG + Intronic
1023474613 7:40563389-40563411 TTTCTTTAGCATTTCCTAGAAGG - Intronic
1023796188 7:43794307-43794329 TTCCTTTAGCATTTCCTGTAGGG - Intronic
1023853588 7:44165511-44165533 TCCCTTTAGCATTTCCTATAGGG - Intronic
1024137719 7:46427671-46427693 TTCCTTTAGCCTTTCCTTTATGG - Intergenic
1024316448 7:48022989-48023011 TCCCTTTAGCACTTCCTGAAGGG - Intronic
1024834353 7:53498665-53498687 TTCCTTAAGCATTTCATGTAAGG + Intergenic
1025138798 7:56445135-56445157 TCCCTTTAGCATTTCTTGTAGGG - Intergenic
1026513969 7:71050886-71050908 TCCCTTTAGCATTTCTTGTAAGG - Intergenic
1027380578 7:77604886-77604908 CTCCTTTGCCACTTACTGAACGG + Intronic
1027506084 7:79018374-79018396 TTCCTTTAGGATCTCTTGAAAGG - Intronic
1027767359 7:82362477-82362499 GTCCTTTTGTATTTCCTGAATGG - Intronic
1028617778 7:92789275-92789297 TCCCTTTAGCATTTCCTGTAGGG - Intronic
1029178357 7:98681642-98681664 ATCTTTAAGCACTTCCTGGATGG + Intergenic
1030534242 7:110745728-110745750 TTCCTTGAGGAGTTCCTGTAGGG - Intronic
1030701974 7:112649919-112649941 TCCCTTTAGCATTTCTTGTAAGG - Intergenic
1030911620 7:115257177-115257199 TTTTTTCAGCACTTCCTGATCGG - Intergenic
1031106040 7:117544348-117544370 TTCCTTTACCATTTCCCTAAAGG + Intronic
1031758814 7:125683442-125683464 CTCCTTTAGCATTTCTTGCAGGG - Intergenic
1032809937 7:135402855-135402877 TTCTTTTACTACTTCCTTAATGG + Intronic
1033055058 7:138044388-138044410 TCCCTTTGGCACATCCAGAAAGG + Intronic
1034611227 7:152370987-152371009 TTTCTTTAGCATTTCTTGTAAGG - Intronic
1035516752 8:240182-240204 TCCCTTTAGCATTTCTTGTAAGG + Intronic
1035710036 8:1706083-1706105 TTCCTTTAGCACTTTGTTTATGG - Exonic
1036737792 8:11333728-11333750 TCCCTTTAGCATTTCTTGTATGG - Intergenic
1038368285 8:26960596-26960618 TACCTTTATTACTTCTTGAAAGG - Intergenic
1038514504 8:28174797-28174819 TTCCTTTAGCATTTCTTATAGGG + Intronic
1039002129 8:32993604-32993626 TCCCTTTAGCATTTCTTGTAGGG + Intergenic
1041532909 8:58891619-58891641 TTCCTTTTTCCCATCCTGAAGGG - Intronic
1041536456 8:58931376-58931398 TTCCTTTAACCTTTCCTCAAAGG - Intronic
1042636192 8:70878136-70878158 TTCCTTCAGGAGTTCCTGTAAGG - Intergenic
1042778169 8:72458826-72458848 TTCTTTTAACACTTCTTGCAAGG + Intergenic
1043505884 8:80901838-80901860 TTTCTTTAGCACTTGTTGGAAGG - Intergenic
1043761432 8:84073986-84074008 TATGTTTAGCACTTCCTTAAGGG + Intergenic
1045599864 8:103701129-103701151 TTCCTTCAGTATTTCTTGAAGGG + Intronic
1045730702 8:105236992-105237014 TTCCTTTAGCCATTTCTTAAGGG + Intronic
1045733147 8:105264744-105264766 TCCCTTTAGCATTTCTTGTAAGG + Intronic
1045903945 8:107320103-107320125 TACTTTTTTCACTTCCTGAATGG + Intronic
1046336368 8:112794060-112794082 TAAATTTAGCAGTTCCTGAAAGG - Intronic
1046440890 8:114252915-114252937 TTTCTTTAGCAGTTACTAAATGG - Intergenic
1047145523 8:122194474-122194496 TTTCTTTAACACTTACAGAATGG + Intergenic
1048884192 8:138896126-138896148 TTCCTTTAGCAATTCTTCAAAGG - Intronic
1050676515 9:8061837-8061859 TTCCTTAAGCATTTCTTGTAGGG + Intergenic
1051195102 9:14555644-14555666 TTCAGTTATCACTTCCTGGAGGG - Intergenic
1051254393 9:15197969-15197991 TTCCTTTAGCATTTCTTAGAGGG - Intronic
1051752552 9:20358607-20358629 TCACTTAAGCCCTTCCTGAATGG - Intronic
1052214429 9:25949362-25949384 TCCCTGTAGCACTTCTTGTAGGG + Intergenic
1052541750 9:29819273-29819295 TTCCTTTAGCATTTCTTGTAAGG - Intergenic
1052584956 9:30415006-30415028 TTCCCACAGCACATCCTGAAGGG - Intergenic
1052702361 9:31952580-31952602 TCCCTTTAGCACTTCTTGTAAGG - Intergenic
1052844796 9:33325775-33325797 TTCTTTTAGTACTTACTGTAAGG - Intronic
1053184270 9:36002232-36002254 TTCCCTTAGCCCCTGCTGAAAGG - Intergenic
1055211543 9:73800765-73800787 TCCCTTTAGCATTTCTTGAAAGG - Intergenic
1055705644 9:78999257-78999279 TTCCTTTAGCATTTCTTGTAGGG + Intergenic
1055905044 9:81283812-81283834 CTTCCTTAGCATTTCCTGAAAGG - Intergenic
1056021843 9:82445989-82446011 TTCCTTTAGCTCTGCCTACACGG - Intergenic
1056734354 9:89194005-89194027 TCCCTGTACCACTTACTGAAAGG - Intergenic
1056742692 9:89273487-89273509 TTCCTTTAGTATTTCCTGTAAGG + Intergenic
1056879005 9:90370938-90370960 TTCCTTTAGGATTTCTTGTAAGG - Intergenic
1057079928 9:92166112-92166134 TCCCTTTAGCATTTCTTGTAGGG - Intergenic
1057239369 9:93394747-93394769 TCCCTTGAGCATTTCTTGAAGGG + Intergenic
1057451576 9:95166958-95166980 TCCCTTTAGCAATTCTTGTAAGG + Intronic
1057637717 9:96786384-96786406 TTCCTGAAGCACAACCTGAAAGG + Intergenic
1058389167 9:104475246-104475268 TTCCTATACCACTTCAGGAATGG + Intergenic
1058982421 9:110182450-110182472 TTGCTTTTGTACATCCTGAAGGG - Intergenic
1059207341 9:112479227-112479249 TCCCTTAAGCAATTCCTGCAAGG - Intronic
1059463738 9:114452218-114452240 TTACTTAAACACATCCTGAATGG + Intronic
1059678321 9:116561916-116561938 TTCCTTTAGGAATTCCCTAATGG + Intronic
1060358870 9:122935821-122935843 TCTCTTTAGCATTTCTTGAAGGG + Intergenic
1061915165 9:133747432-133747454 TCCCTTTAGCATTTCTTGTAAGG + Intergenic
1203422062 Un_GL000195v1:2013-2035 TTCCTTTAGCATTCCCTGTTTGG + Intergenic
1186314392 X:8352980-8353002 TTGATTTAGCAAGTCCTGAAAGG + Intergenic
1186624253 X:11275523-11275545 TTCCTTTAACACTTCCTCTCTGG + Intronic
1186711809 X:12205693-12205715 TTCCTTTATAACTTCCTACAGGG + Intronic
1187380402 X:18796578-18796600 TTTCTTTAACAATTACTGAAGGG - Intronic
1187531525 X:20101081-20101103 CTCCCTTAGCACATCCTGAAAGG + Intronic
1187643873 X:21325169-21325191 TTCTTTTAACATTTCTTGAAAGG + Intergenic
1188299770 X:28494119-28494141 TTCCTTTAGCCTTTCATTAAGGG + Intergenic
1188863057 X:35281037-35281059 TTCCTTTAACACTTATTGTAAGG + Intergenic
1189533748 X:41914682-41914704 TTACTTTGTCACTTCATGAAAGG + Intronic
1189892849 X:45623648-45623670 TGCCTATAGCACTTTGTGAATGG + Intergenic
1190005549 X:46733348-46733370 TTCCTTTAGTATTTCTTGTAAGG - Intronic
1190032254 X:46985331-46985353 ATCCTTCAGCACTTCCCCAAAGG - Intronic
1190961343 X:55252083-55252105 TCCCTTTAGCATTTCCTGTAAGG + Intronic
1191178441 X:57532791-57532813 TCCCTTTAGCATTTCTTGAAAGG + Intergenic
1191827119 X:65377743-65377765 TTCCTTTAGCATTTGATGTAGGG - Intronic
1192024077 X:67429553-67429575 TTCCTTTAGTATTTCTTGCATGG + Intergenic
1192062708 X:67845261-67845283 TCCCTTTAGCATTCCCTGTAAGG - Intergenic
1192111552 X:68370159-68370181 TCCCTTTAGCATTTCTTGTAGGG - Intronic
1192279531 X:69670055-69670077 TTCCTTAAGCATTTCTTGTAGGG + Intronic
1192332883 X:70192319-70192341 TTTCTTTAGCATTTCTTGTAAGG - Intronic
1192433933 X:71130814-71130836 TTCCTTTAGCTTTTCCTCAACGG - Intronic
1192700635 X:73467484-73467506 TCCCTTTAGCATTTCTTGTAGGG + Intergenic
1192821546 X:74651611-74651633 TCCCTTTAGCATTTCTTGTAGGG + Intergenic
1192972047 X:76242557-76242579 TCCCTTTAGCATTTCCTCCAAGG - Intergenic
1193281970 X:79662456-79662478 TTCCTTTAACATTTCTTGCAGGG + Intergenic
1193355782 X:80519358-80519380 TTCCTTTAGGAGCTCCTGTAAGG + Intergenic
1193466226 X:81851038-81851060 TTCCTTTAGGAATTCTTGTAAGG - Intergenic
1193749428 X:85324855-85324877 TTCCTTTAGGACTTCTTGTAAGG + Intronic
1193970924 X:88051565-88051587 TCCCTTTAGCATTTCTTGTAGGG - Intergenic
1194197348 X:90911326-90911348 TTTCTTTAGCAATTCATGTAAGG - Intergenic
1194248201 X:91540234-91540256 TTCCTTTAGGACTTCTTGTAAGG - Intergenic
1194274617 X:91864150-91864172 TCCCTTTAGCATTTCTTGTAGGG + Intronic
1194330356 X:92576971-92576993 TTCCTGTAGCATTTCTTGCAGGG + Intronic
1194368646 X:93041943-93041965 TTCTTTGAGCATTTCCTGTATGG + Intergenic
1194509596 X:94777118-94777140 TTCTTTTAGCACTTACTTCATGG + Intergenic
1194538833 X:95144869-95144891 TCCCTTTAGCAATTCCTGTAAGG + Intergenic
1194561747 X:95429951-95429973 TCCCTTTAGCATTTCTTGTAGGG - Intergenic
1194564214 X:95463028-95463050 TCCCTTTAGCATTTCTTGAAGGG - Intergenic
1194689263 X:96962992-96963014 TTCCTTAAGCATTTCTTGTAGGG + Intronic
1194904387 X:99556535-99556557 TTCCTTTAGCATTTCTTGTAAGG + Intergenic
1195242865 X:102969971-102969993 TTCCTTTAGTATTTCTTGTAGGG - Intergenic
1195548613 X:106140596-106140618 TTCCTTTAGCAGTTCTTGTAAGG - Intergenic
1195820278 X:108937792-108937814 TCCCTTTAGCATTTCTTGCATGG + Intergenic
1196494166 X:116305131-116305153 TCCCTTTAGCATTTACTGTAGGG + Intergenic
1196660736 X:118266150-118266172 TCCCTTTAGCATTTCTTGTAGGG - Intergenic
1196994854 X:121371641-121371663 TTTCTTTAGCATTTCTTGTAAGG + Intergenic
1197956616 X:131956592-131956614 TTCCTTTAGCATTTATTGTAGGG - Intergenic
1198608859 X:138374413-138374435 TCCCTTTAGCATTTCTTGTAAGG - Intergenic
1199156341 X:144553032-144553054 TCCCTTTAGCATTTCTTGTAAGG - Intergenic
1199303305 X:146237997-146238019 TTCGTTTAGCTATTCCTGAGGGG + Intergenic
1199442847 X:147888229-147888251 TTCCTTTAGCATTTCTTGTAGGG + Intergenic
1200332089 X:155308893-155308915 TCCCTTTAGCATTTCTTGTAGGG - Intronic
1200359999 X:155594464-155594486 TCCCTTTAGTAATTCCTGCAGGG - Intronic
1200544371 Y:4501467-4501489 TTTCTTTAGCAATTCATGTAAGG + Intergenic
1200591859 Y:5085553-5085575 TCCCTTTAGCATTTCTTGTAGGG + Intronic
1201979871 Y:19894835-19894857 TTCCTTTAGCAGCTCTTGCAAGG - Intergenic
1202201760 Y:22359374-22359396 TTCCATTTACACTTCCTGCATGG - Intronic