ID: 977640686

View in Genome Browser
Species Human (GRCh38)
Location 4:99355195-99355217
Sequence CTCATCACTGCTGAGAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977640682_977640686 -7 Left 977640682 4:99355179-99355201 CCTCTGAGGCCTAGACCTCATCA No data
Right 977640686 4:99355195-99355217 CTCATCACTGCTGAGAAAGGAGG No data
977640678_977640686 30 Left 977640678 4:99355142-99355164 CCCAAATAGACTCTTTGACAGCA 0: 5
1: 152
2: 82
3: 41
4: 174
Right 977640686 4:99355195-99355217 CTCATCACTGCTGAGAAAGGAGG No data
977640679_977640686 29 Left 977640679 4:99355143-99355165 CCAAATAGACTCTTTGACAGCAG No data
Right 977640686 4:99355195-99355217 CTCATCACTGCTGAGAAAGGAGG No data
977640681_977640686 -1 Left 977640681 4:99355173-99355195 CCAAAACCTCTGAGGCCTAGACC No data
Right 977640686 4:99355195-99355217 CTCATCACTGCTGAGAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977640686 Original CRISPR CTCATCACTGCTGAGAAAGG AGG Intergenic
No off target data available for this crispr