ID: 977644026

View in Genome Browser
Species Human (GRCh38)
Location 4:99391026-99391048
Sequence CTGTGTACTCACATGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977644024_977644026 -5 Left 977644024 4:99391008-99391030 CCTTGGAGGGGAGGAAGACTGTG No data
Right 977644026 4:99391026-99391048 CTGTGTACTCACATGGAAAAAGG No data
977644016_977644026 29 Left 977644016 4:99390974-99390996 CCAGCAGGTTTGGTTGTCTGGTG No data
Right 977644026 4:99391026-99391048 CTGTGTACTCACATGGAAAAAGG No data
977644023_977644026 -4 Left 977644023 4:99391007-99391029 CCCTTGGAGGGGAGGAAGACTGT No data
Right 977644026 4:99391026-99391048 CTGTGTACTCACATGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977644026 Original CRISPR CTGTGTACTCACATGGAAAA AGG Intergenic
No off target data available for this crispr