ID: 977644389

View in Genome Browser
Species Human (GRCh38)
Location 4:99395645-99395667
Sequence AGGGAGAGTGCAGTGATAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977644380_977644389 21 Left 977644380 4:99395601-99395623 CCCGGTAGCAGCTTTGTGGTGCA No data
Right 977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG No data
977644379_977644389 22 Left 977644379 4:99395600-99395622 CCCCGGTAGCAGCTTTGTGGTGC No data
Right 977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG No data
977644381_977644389 20 Left 977644381 4:99395602-99395624 CCGGTAGCAGCTTTGTGGTGCAG No data
Right 977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG No data
977644377_977644389 30 Left 977644377 4:99395592-99395614 CCATCATACCCCGGTAGCAGCTT No data
Right 977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977644389 Original CRISPR AGGGAGAGTGCAGTGATAGT GGG Intergenic
No off target data available for this crispr