ID: 977646511

View in Genome Browser
Species Human (GRCh38)
Location 4:99418729-99418751
Sequence ACTACTGGTGTCTCTCATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977646507_977646511 6 Left 977646507 4:99418700-99418722 CCTGTTACATAATTCATCCCTAT 0: 1
1: 0
2: 0
3: 12
4: 171
Right 977646511 4:99418729-99418751 ACTACTGGTGTCTCTCATTCAGG 0: 1
1: 0
2: 1
3: 9
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977646511 Original CRISPR ACTACTGGTGTCTCTCATTC AGG Intronic
907557205 1:55354456-55354478 ACTTCTGGGATTTCTCATTCTGG + Intergenic
908481888 1:64548613-64548635 ACTACCGGTGTTTTACATTCAGG - Intronic
910769446 1:90816270-90816292 TCTAGTGGTATCTCTCATTGAGG - Intergenic
912159142 1:106959801-106959823 AGTACTGGTATTTCTCATTTGGG - Intergenic
912167846 1:107061163-107061185 AAAACTGTTGTCACTCATTCAGG - Intergenic
912621241 1:111160861-111160883 AGTACTAGTGTCTCTAAGTCAGG + Intronic
913507492 1:119531287-119531309 ACTACTTGTGGCTTTCATACTGG + Intergenic
1062825332 10:563915-563937 ACTGCTGAGGTCGCTCATTCAGG + Intronic
1063833807 10:9988105-9988127 ACTACTGGTGTATTTTCTTCTGG + Intergenic
1066137389 10:32463518-32463540 ACTACTGGTCTCTGTCCTTAGGG + Intronic
1068842752 10:61633485-61633507 ACTACTGATATCTTTTATTCTGG - Intergenic
1070211931 10:74332614-74332636 ACTACTGATGACTCTCAATTAGG - Intronic
1076518311 10:131062507-131062529 GCTACTGGAGTCTCTCACCCTGG - Intergenic
1077245712 11:1536781-1536803 CCCACAGGTCTCTCTCATTCTGG - Intergenic
1085647958 11:78240198-78240220 GCTACTGGGGTACCTCATTCTGG - Intronic
1086063505 11:82723780-82723802 ACTACTTGTGTCTGACATACAGG - Intergenic
1091185986 11:133648403-133648425 ATTACTGTTCTCTCTCATTGTGG - Intergenic
1092114432 12:5988848-5988870 ACTCCTGCTGGCTCTCATACCGG - Intronic
1097390718 12:59009297-59009319 ATTATTGGTGTCCCTCCTTCAGG + Intergenic
1098489972 12:71064186-71064208 CCTACTGGTGTCTCTTAGTCTGG + Intronic
1099937045 12:89138765-89138787 ACCACTGGTGTATGTCATCCAGG + Intergenic
1100913131 12:99388199-99388221 ACTATTGATGTCTCTCATTTAGG - Intronic
1104089453 12:125503040-125503062 ACTCCTGGGATCTCTCATTAGGG + Intronic
1111281791 13:86035967-86035989 ACTGCAGGTGTTTCTCATGCAGG + Intergenic
1112534601 13:100239613-100239635 ATTACTGTTGTCTATCATTGAGG - Intronic
1114222949 14:20713422-20713444 AATACTGGTGTGACTTATTCAGG - Intergenic
1118014139 14:61641058-61641080 ACTACTTGTGTTTCTCCTTGTGG + Intronic
1124605936 15:31170466-31170488 ACATCTGGTGTCTCTCACCCTGG + Intergenic
1126607716 15:50495740-50495762 ACTACAGGTGTTTCTAAATCTGG + Intronic
1127631926 15:60835518-60835540 TTCACTGGTGTCTCACATTCTGG - Intronic
1135060686 16:19269008-19269030 CCTCATGGTGTCTCCCATTCTGG + Intergenic
1138311668 16:56029055-56029077 ATACCTGGTGTCTCTCATTGAGG - Intergenic
1146787203 17:35731181-35731203 AATGCTGGTATCTCCCATTCTGG + Intronic
1151662484 17:75525987-75526009 TCTACAGGTGTCTCTCTTCCAGG - Intronic
1152437416 17:80284921-80284943 ACCACTGATGTCTATCATCCTGG - Intronic
1156546303 18:37967058-37967080 ACTCTTGCTGTCTCTCCTTCTGG - Intergenic
1158024135 18:52875866-52875888 CCTTCTGGGATCTCTCATTCCGG + Intronic
1158125521 18:54095936-54095958 ACCACTGCTGTCTCTCCTTCAGG - Intergenic
1159474690 18:68905702-68905724 ACTTCTGCTTTCTGTCATTCTGG + Intronic
1159883030 18:73877772-73877794 TCTTCTGGGGTTTCTCATTCTGG + Intergenic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
925318639 2:2944229-2944251 AGTACAGGTGTCTCACACTCTGG - Intergenic
927116779 2:19911830-19911852 CCCACTGGTGACACTCATTCTGG + Exonic
929231914 2:39568852-39568874 TCTACTAGGGTCTCTCTTTCCGG + Intergenic
930105526 2:47636180-47636202 ACCTCTGGAGTTTCTCATTCAGG + Intergenic
934050889 2:88209883-88209905 AGTACTAGTTTCTCTGATTCTGG + Intergenic
935337019 2:102025654-102025676 TCTACTGCTGACTCTCACTCTGG - Intronic
936814123 2:116438593-116438615 ATTTCTGATTTCTCTCATTCTGG + Intergenic
937600644 2:123727365-123727387 ACCACTGGTCTCTCCAATTCAGG + Intergenic
938995285 2:136671919-136671941 ACATCTGATGTCTCTCATTGGGG - Intergenic
940091739 2:149927353-149927375 AAAACTGGTGTCTCACATGCAGG - Intergenic
941166739 2:162090923-162090945 AATACTGGTGTATTGCATTCAGG + Intergenic
943198171 2:184782499-184782521 ACTACATGTTTCTCTCATGCTGG + Intronic
943283306 2:185964980-185965002 ACTATTGGTGGGTCTCATTCAGG + Intergenic
945994036 2:216420970-216420992 ACTACTGGAGTTTCTGATTCTGG + Intronic
946960711 2:224982975-224982997 AACACTGGTGTCTCTCACTCAGG - Intronic
947009123 2:225546640-225546662 ACCACTGGGGTCCCTGATTCTGG - Intronic
1176420943 21:6514825-6514847 ACCACTGCTCTCTCCCATTCTGG - Intergenic
1177743156 21:25178076-25178098 ACTGCTGTTTTCTCCCATTCTGG - Intergenic
1179500246 21:41804306-41804328 AATACTGGTGTATCTCACTTTGG - Intronic
1179696434 21:43123144-43123166 ACCACTGCTCTCTCCCATTCTGG - Intergenic
1184892716 22:47389601-47389623 ACTGCTGGTGTCTCTGTTTGGGG - Intergenic
950400023 3:12762785-12762807 ACTCCTGGAGTTTCTGATTCAGG - Intronic
955084937 3:55693504-55693526 ACTACTTGAGGATCTCATTCTGG + Intronic
957007436 3:74966450-74966472 ACTACTGATGTGTTTAATTCTGG + Intergenic
959776385 3:110169082-110169104 GGTACTGGAGTCTCTCTTTCTGG - Intergenic
962791173 3:138812827-138812849 ATTACAAGAGTCTCTCATTCTGG - Intronic
963940092 3:151088627-151088649 ACGACTGGGGCCTCTGATTCTGG + Intronic
970962716 4:21891468-21891490 ATCACTGGTGTCTATCCTTCAGG - Intronic
977034219 4:91928966-91928988 ACTTCTGGTATCTCTGTTTCAGG - Intergenic
977646511 4:99418729-99418751 ACTACTGGTGTCTCTCATTCAGG + Intronic
979997673 4:127451765-127451787 ACTACAAGTTTCTCTCATGCAGG - Intergenic
980169602 4:129273300-129273322 GCTCCAGGTGTCTCTCATTCTGG + Intergenic
984581254 4:181512214-181512236 ACTACTTCTGTCTCTCATGTAGG + Intergenic
985486738 5:156130-156152 ACTGCTTGTGTCTCTCAGGCTGG + Exonic
985526118 5:402752-402774 GCTACTGGTGTCTCTGATTCTGG - Intronic
992286694 5:75242750-75242772 ACTAATGGTATCTGTTATTCTGG + Intergenic
993976847 5:94493353-94493375 ACTAATGGTGTCACCCTTTCAGG + Intronic
994289559 5:98012492-98012514 ACCATTGGTGTCTCTCATTGGGG + Intergenic
1000048712 5:157543677-157543699 AATACTAGTCTCTCTCCTTCTGG + Intronic
1002406950 5:179042119-179042141 ACTACAGGTTTCTGTCATCCAGG + Intergenic
1003562618 6:7195436-7195458 ACTACTAGAGTCTCAGATTCTGG - Intronic
1007214557 6:40227379-40227401 ACTACAGGTGACTATAATTCTGG + Intergenic
1013635931 6:112029211-112029233 ACTGCTGGAGTCTCGCATTGTGG + Intergenic
1018545156 6:164927775-164927797 GCTTCTGCTGTCTCTCATTAAGG + Intergenic
1022435235 7:30377136-30377158 ACTACTGGTGCCTCTTATGCGGG - Intronic
1022519306 7:30995529-30995551 ACGACTGGTCCCTCTCAGTCTGG - Intergenic
1024294162 7:47829704-47829726 ACTACTGGTGTCTTTAAAACTGG - Intronic
1026204234 7:68241675-68241697 AGTACTTGTGTCTCTTTTTCTGG - Intergenic
1028104159 7:86857529-86857551 TCTACTGCTATCTCTCACTCTGG - Intronic
1030608318 7:111661818-111661840 CAGAATGGTGTCTCTCATTCTGG + Intergenic
1032282243 7:130513450-130513472 TCTTCTGGTGTTCCTCATTCTGG - Intronic
1035920203 8:3668229-3668251 ACCACTGCTGGATCTCATTCTGG + Intronic
1041962749 8:63637519-63637541 ACCACTTGTGTCTCTAATGCAGG + Intergenic
1043416324 8:80054153-80054175 ACTATTCGTCTCTCTCACTCAGG + Intronic
1046507500 8:115154871-115154893 CCTCCTTATGTCTCTCATTCTGG - Intergenic
1046972467 8:120238050-120238072 ACTCCTGGTGTCTCCCCATCAGG + Intronic
1047681103 8:127254994-127255016 ATTACTGAGGTCTCTAATTCAGG + Intergenic
1048244234 8:132775711-132775733 CATTCTGGTGTCTCTCTTTCCGG + Intronic
1050507338 9:6361750-6361772 GCCACTGGTCTCTATCATTCTGG + Intergenic
1055520353 9:77074614-77074636 AATACTGGAGTCTCTCACTTAGG - Intergenic
1057706041 9:97395885-97395907 ACTCCTGGGGTCTCTCAAGCAGG - Intergenic
1058324019 9:103672581-103672603 ACTCCTGGAGTTTCTGATTCAGG + Intergenic
1060495304 9:124113861-124113883 ACTACATGTGTCTCTGAGTCTGG + Intergenic
1060795452 9:126509788-126509810 ATTGCTGGTGTCTGTCCTTCTGG - Intergenic
1062312463 9:135946329-135946351 GATACTGGTGTCTCTCATCGAGG - Exonic
1186938637 X:14479080-14479102 ACTTCTGTCTTCTCTCATTCCGG - Intergenic
1189554800 X:42131007-42131029 ATTTCTGGTGTCTCTGAATCTGG + Intergenic
1190196431 X:48323201-48323223 ACTTGTGGAGTCACTCATTCAGG - Intergenic
1190209342 X:48432378-48432400 ACTTGTGGGGTCACTCATTCAGG - Intergenic
1190660447 X:52649544-52649566 ACTTGTGGGGTCACTCATTCAGG + Intronic
1198836251 X:140807580-140807602 ACTCCTGTTGTTTCTCACTCTGG + Intergenic