ID: 977655728

View in Genome Browser
Species Human (GRCh38)
Location 4:99518724-99518746
Sequence TGGCATATGCATAATGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977655728_977655735 14 Left 977655728 4:99518724-99518746 CCTCCCCCATTATGCATATGCCA 0: 1
1: 0
2: 1
3: 15
4: 157
Right 977655735 4:99518761-99518783 AAGTTGCTTGAACATGTCACAGG 0: 1
1: 0
2: 1
3: 14
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977655728 Original CRISPR TGGCATATGCATAATGGGGG AGG (reversed) Intronic
900578578 1:3396260-3396282 TAGGATATTCATAAAGGGGGTGG - Intronic
900723967 1:4202700-4202722 AGGCAAATGGATAATGGGGGCGG - Intergenic
902665699 1:17936112-17936134 AGGCAATTGCATCATGGGGGCGG + Intergenic
904346843 1:29878311-29878333 TGGAATATGCACAATGATGGTGG - Intergenic
905812816 1:40925493-40925515 TGGCCAATGCATAAGGAGGGAGG - Intergenic
908065908 1:60404100-60404122 AGGCATAGGCATAGTGGTGGGGG - Intergenic
908603426 1:65765951-65765973 AGGCAATTGAATAATGGGGGTGG - Intergenic
910171529 1:84382974-84382996 TGGAAGCTGCATTATGGGGGTGG - Intronic
912532152 1:110333100-110333122 AGGCATTTGGATCATGGGGGAGG - Intergenic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
913404967 1:118480240-118480262 GGGGGTGTGCATAATGGGGGAGG + Intergenic
917702741 1:177597497-177597519 TTGCATATGTTTAATGGGGGAGG - Intergenic
918289074 1:183088832-183088854 TGGCATATGGATAATAGGGATGG + Intronic
920162217 1:204007737-204007759 TGGGATGTTAATAATGGGGGAGG + Intergenic
922181318 1:223235291-223235313 GGGGATGTGAATAATGGGGGAGG - Intronic
924850488 1:247824214-247824236 TGACATTTGCATAATGCCGGGGG + Intergenic
1062957064 10:1547405-1547427 TGGCGTATGCACTATGGGGAGGG + Intronic
1064069348 10:12212834-12212856 TTGCATATACATAATGGGGATGG - Intronic
1068271860 10:54737991-54738013 AGCCAAATGGATAATGGGGGAGG + Intronic
1068590921 10:58852228-58852250 AGGGATATTGATAATGGGGGAGG + Intergenic
1069135803 10:64763753-64763775 AGGCATCTGCATTATGGGGATGG - Intergenic
1069332434 10:67308609-67308631 TGGTATATGCATAATGAGTATGG + Intronic
1070161757 10:73871090-73871112 TGGCATATCCATCTTGGGAGAGG + Intronic
1070291087 10:75114788-75114810 TGGCATATGAAAAATGAAGGGGG - Intronic
1070324399 10:75378440-75378462 TGGCTTATGCTTCCTGGGGGAGG + Intergenic
1071713758 10:88074693-88074715 TGACATATGTTTGATGGGGGAGG + Intergenic
1072171068 10:92862333-92862355 TAACATATGAATTATGGGGGGGG - Intronic
1074037942 10:109759801-109759823 TGGCCTATGCATAAAGGTGGCGG - Intergenic
1074309334 10:112308673-112308695 TGTCATCTGCAAAATGGGGGTGG - Intergenic
1075394193 10:122114633-122114655 TGGCATTTGCACAAGGAGGGTGG - Intronic
1075518058 10:123125233-123125255 TTGCAAATGCACAATGGGGTTGG - Intergenic
1081273282 11:41114362-41114384 TGGCATATACATAAGAGGGAAGG - Intronic
1082852969 11:57781718-57781740 AGGCACATGGATAATGGGGGAGG + Intronic
1083682991 11:64359764-64359786 GGGCATTTGCAAAATGTGGGAGG - Intronic
1085153938 11:74276138-74276160 TGGAAACTGCAAAATGGGGGAGG + Intronic
1086150500 11:83604709-83604731 TGGAATTTTGATAATGGGGGTGG + Intronic
1088495443 11:110427363-110427385 TAGCATAGGCAAAATGGGGCAGG - Intergenic
1089831618 11:121333846-121333868 TGGGATGTGGATAGTGGGGGAGG + Intergenic
1090457778 11:126864839-126864861 TGGTATATGCATGATGGAGAGGG - Intronic
1090649292 11:128792266-128792288 GGGGAAATGCATGATGGGGGTGG - Intronic
1093109563 12:15133004-15133026 TGGGATATGAATAATGGGGGAGG - Intronic
1093778202 12:23101988-23102010 TGGCATTTCCATAATGGTGGAGG + Intergenic
1095392019 12:41718793-41718815 TTGCAGATGCATTATGGGTGTGG - Intergenic
1100793846 12:98159157-98159179 TAGCAGATTCATAATGTGGGAGG - Intergenic
1103149720 12:118626568-118626590 TGGCATAGGCAAAATTGGGAGGG + Intergenic
1105266968 13:18828636-18828658 GGGCATGTGCATCATGGGGTTGG - Intergenic
1106045439 13:26135755-26135777 TGGTGTTTGCATCATGGGGGTGG + Intronic
1107566351 13:41609277-41609299 AGGCATATGCAGAATGAGGTCGG - Intronic
1113971290 13:114192289-114192311 GGGCATGTTGATAATGGGGGAGG + Intergenic
1115382282 14:32754399-32754421 TGACATCAGCAAAATGGGGGAGG - Intronic
1119028941 14:71176415-71176437 GGGGATGTGGATAATGGGGGAGG - Intergenic
1119561496 14:75593587-75593609 AGGCATTTGGATCATGGGGGAGG - Intronic
1122105986 14:99455286-99455308 TGCGATATGCATGATGGGGTGGG - Intronic
1122877512 14:104675647-104675669 GGACAGATGGATAATGGGGGTGG + Intergenic
1124057791 15:26258560-26258582 TGCCATGTGCATACTGGGGATGG + Intergenic
1129170418 15:73804179-73804201 TGACATCTGCAGAATGGGTGTGG + Intergenic
1129688844 15:77701791-77701813 TGGCATCTGCATCAGGGGAGGGG - Intronic
1131648595 15:94374501-94374523 TGGCATATGCATCATGCCAGTGG - Intronic
1136482775 16:30552971-30552993 TGGTAGATGGATAATGGGGGTGG + Intronic
1137964555 16:52917395-52917417 TGGGAAATGCAAAATGGTGGAGG - Intergenic
1138103649 16:54274834-54274856 TGGGAAATGCAGAATGGGGCTGG - Intergenic
1138773033 16:59687618-59687640 AGGCAACTGGATAATGGGGGTGG - Intergenic
1141119085 16:81336868-81336890 TGGTATACTGATAATGGGGGAGG - Intronic
1144504286 17:15817115-15817137 TATCACATGCACAATGGGGGGGG - Intergenic
1145168142 17:20632624-20632646 TATCACATGCACAATGGGGGGGG - Intergenic
1145229378 17:21161260-21161282 AGGGATGTGGATAATGGGGGAGG + Intronic
1149288295 17:55190449-55190471 TGGCATATGAATAGTGGTGGTGG - Intergenic
1150680988 17:67284326-67284348 GGGGATATTGATAATGGGGGAGG + Intergenic
1153729948 18:8000940-8000962 TGGCCTATGAAGAATGGTGGTGG + Intronic
1154421442 18:14232801-14232823 AGGCATGTGCATCATGGGGTTGG + Intergenic
1155137014 18:23005858-23005880 TTGCATCTGCATAATGAGGAGGG - Intronic
1156243485 18:35275606-35275628 TGGCATATGATTGATGGGGAAGG - Intronic
1157949186 18:52015484-52015506 TGGCATATACATAAAGCAGGTGG - Intergenic
1159736511 18:72105611-72105633 TGGAATGTTGATAATGGGGGAGG + Intergenic
1160468640 18:79105741-79105763 TGGCATTTCCATAAGAGGGGAGG + Intronic
1168343343 19:55638627-55638649 AGGCATTTGGATCATGGGGGTGG - Intronic
927158030 2:20233082-20233104 TTGCATATGCATCCTGGGGCTGG - Intergenic
930537937 2:52667277-52667299 TGGCAATTGGATCATGGGGGTGG - Intergenic
937951191 2:127388912-127388934 TGGAATATGCATGAAAGGGGTGG - Intergenic
938712826 2:133990311-133990333 TGGCATAAGCATCATGGGCAGGG + Intergenic
941747873 2:169106331-169106353 TCTCATCTGTATAATGGGGGTGG + Intergenic
942847507 2:180444183-180444205 TGGCACTTCCATAATGGAGGTGG + Intergenic
944496482 2:200312217-200312239 TGGCATTTCCATAATGCAGGAGG - Intronic
945316055 2:208371802-208371824 TGACATACTCATAATGGGGTAGG + Intronic
945674131 2:212834348-212834370 TGGGATATTGATAGTGGGGGAGG - Intergenic
945885590 2:215372131-215372153 TGGCCTATGCCTTATGGGGGTGG + Exonic
947835565 2:233172363-233172385 TGGCATGTGCAGAATTGTGGTGG + Intronic
948240501 2:236429311-236429333 TTGCATATGCATAATTGCAGAGG + Intronic
1169233808 20:3912341-3912363 TGGCATTTGCATGATTGGGTTGG + Intronic
1170164290 20:13345571-13345593 TGGCATATCTACACTGGGGGAGG + Intergenic
1170546062 20:17436753-17436775 TGGCATATGACTGATGGAGGAGG - Exonic
1170922496 20:20691879-20691901 AGACATATGGATCATGGGGGTGG + Intronic
1171139614 20:22729540-22729562 TGGCATATGGGAGATGGGGGTGG - Intergenic
1172299082 20:33835958-33835980 AGGCATCTGGATCATGGGGGCGG - Intronic
1173570996 20:44075958-44075980 TGGCAAATGCATAGTGGCGTAGG - Intergenic
1176852031 21:13927149-13927171 AGGCATGTGCATCATGGGGTTGG - Intergenic
1177585579 21:23090104-23090126 TGGCATATCCACAATGGAGATGG - Intergenic
1177673592 21:24267302-24267324 ATGCATATGCATAATAGTGGAGG - Intergenic
1177893548 21:26835077-26835099 AGGTAAATGCATCATGGGGGCGG + Intergenic
1177952315 21:27553405-27553427 AGGTAAATGAATAATGGGGGTGG - Intergenic
1181824197 22:25500840-25500862 AGGCAAATGGATCATGGGGGTGG - Intergenic
1182178562 22:28319540-28319562 TGGGATGTCAATAATGGGGGAGG + Intronic
1182844499 22:33419238-33419260 AGGCAATTGCATTATGGGGGTGG - Intronic
952339086 3:32430342-32430364 AGGCATAAGCAGAATGGGGATGG - Intronic
955672454 3:61416093-61416115 AGGTAGATGCATCATGGGGGTGG - Intergenic
956756296 3:72391045-72391067 TGGCATGTGAAGAATGAGGGTGG - Intronic
957120379 3:76082990-76083012 TGGCATATATGTAATGAGGGAGG + Intronic
959133296 3:102385254-102385276 TGGAAGAGGCAGAATGGGGGTGG - Intronic
960363233 3:116739670-116739692 TGGCATATGCTCAAGGGGAGAGG + Intronic
960433917 3:117602407-117602429 TGGAATATGCATAAGTGCGGGGG + Intergenic
960753601 3:120983292-120983314 TGGCATATGTATATCGGGGCAGG + Intronic
962494277 3:135923834-135923856 AGGACTATGCATAATGTGGGAGG + Intergenic
964726102 3:159815870-159815892 TAGCATTTGCAGAACGGGGGTGG - Intronic
965416435 3:168400422-168400444 TTGCATCTGCATATTGGCGGTGG + Intergenic
966797179 3:183726661-183726683 GGGAATATGCCTAATGAGGGAGG - Intronic
966981494 3:185140247-185140269 TGGCATATAAATAAAGGTGGGGG + Intronic
967442722 3:189527647-189527669 AGGCAGATGCATAATGAGGTGGG - Intergenic
968351120 3:198053341-198053363 AGGCATGTGCGTCATGGGGGCGG - Intergenic
970074042 4:12197001-12197023 AGGTAATTGCATAATGGGGGTGG + Intergenic
970260284 4:14217422-14217444 TAACATATGCATGTTGGGGGAGG - Intergenic
973649339 4:52982204-52982226 CAGCATAAGCATAATGGTGGTGG + Intronic
974178802 4:58359178-58359200 TGGTAATTGAATAATGGGGGTGG + Intergenic
974394026 4:61311950-61311972 TGGGATGTTAATAATGGGGGAGG + Intronic
974869138 4:67617389-67617411 TGGGATATGCACAATGGGAAAGG + Exonic
977655728 4:99518724-99518746 TGGCATATGCATAATGGGGGAGG - Intronic
977728049 4:100320609-100320631 TGGCATATGGATGTTAGGGGAGG + Intergenic
978147843 4:105397632-105397654 AGGTGTATGGATAATGGGGGTGG + Intronic
978243668 4:106547414-106547436 TGGGATGTTGATAATGGGGGAGG + Intergenic
978996521 4:115161969-115161991 TGGCAGATGCATTCTGTGGGGGG + Intergenic
985910193 5:2873395-2873417 CTGAATATGCATAATGGGAGTGG - Intergenic
986615942 5:9617642-9617664 TGGCATGTACTAAATGGGGGTGG - Intergenic
987024085 5:13906317-13906339 GGGGATGTTCATAATGGGGGAGG + Intronic
994477528 5:100290136-100290158 TGGCATAATCATAATGGTGGTGG - Intergenic
995389619 5:111626086-111626108 AGGCACTTGCATCATGGGGGCGG + Intergenic
996610903 5:125379099-125379121 TGGGTTATAAATAATGGGGGCGG - Intergenic
997218148 5:132131867-132131889 TGACAAACGTATAATGGGGGTGG + Intergenic
997775322 5:136599199-136599221 AGGTGTTTGCATAATGGGGGTGG + Intergenic
998940468 5:147276679-147276701 TAGCATAAGCTTAATGAGGGTGG - Intronic
999189554 5:149736859-149736881 GGGAATATTAATAATGGGGGAGG - Intronic
1004751655 6:18568023-18568045 TGGCATATATACAATGGGGGTGG - Intergenic
1005292510 6:24393527-24393549 TGGCATATAGATAATAAGGGAGG - Intergenic
1006590637 6:35153291-35153313 GGGGATATTGATAATGGGGGAGG - Intergenic
1007811893 6:44492110-44492132 AGGCGTTTGCATCATGGGGGTGG + Intergenic
1008358088 6:50579260-50579282 GGGGATATTAATAATGGGGGAGG + Intergenic
1019616387 7:1964832-1964854 TAAAAGATGCATAATGGGGGCGG + Intronic
1021222849 7:17993134-17993156 TTGCATATACATGATGAGGGAGG - Intergenic
1027335995 7:77151268-77151290 TAGCATATGAATATTGGGGCAGG + Intronic
1027429455 7:78095325-78095347 TGGAATATCCATAGTGGGGAAGG - Intronic
1029779790 7:102719828-102719850 TAGCATATGAATATTGGGGCGGG - Intergenic
1032810267 7:135406993-135407015 AGGCATTTGAATCATGGGGGTGG + Intronic
1033889229 7:145988327-145988349 AAGGATATGGATAATGGGGGAGG - Intergenic
1036703223 8:11027888-11027910 TGGGATGTTGATAATGGGGGAGG - Intronic
1043739710 8:83795363-83795385 GGGCATGTTGATAATGGGGGAGG + Intergenic
1046615215 8:116469806-116469828 TGGTCTCTGCATACTGGGGGAGG - Intergenic
1047477373 8:125246575-125246597 TGGAATTTGCATTTTGGGGGAGG - Intronic
1048715597 8:137265232-137265254 TAGCATAGGGAAAATGGGGGTGG + Intergenic
1050533279 9:6609015-6609037 TGGCTTATGCAGAGTTGGGGTGG - Intronic
1061249524 9:129418356-129418378 TGACATATGAATTTTGGGGGTGG + Intergenic
1061388521 9:130304507-130304529 TGGCAGGTGTATAATGGTGGTGG + Intronic
1062010536 9:134264502-134264524 TGGGATCTGCAGAATGGCGGCGG + Intergenic
1185518450 X:718499-718521 TGGCATATTGATAATGGAGGAGG + Intergenic
1185852362 X:3500986-3501008 GGGGATATTGATAATGGGGGAGG + Intergenic
1187027653 X:15452686-15452708 TGGAACATGCATAATGGGTATGG - Intronic
1188576108 X:31652156-31652178 GGCCATATGTATAATTGGGGGGG - Intronic
1188791116 X:34409119-34409141 TGGCATATGCAGAGAGGGTGTGG + Intergenic
1189464969 X:41271638-41271660 GGGGATATTGATAATGGGGGAGG + Intergenic
1189500305 X:41550229-41550251 TGGAAAATGCAAGATGGGGGTGG - Intronic
1190604561 X:52127198-52127220 TGGCATATGCATAACAGTGCTGG - Intergenic
1191792309 X:64983989-64984011 TATTATATGCATAATGGTGGGGG + Intronic
1194184444 X:90756510-90756532 GGGGATATTGATAATGGGGGAGG + Intergenic
1196885096 X:120236900-120236922 ATACATATGCAAAATGGGGGTGG + Intergenic
1199580910 X:149358812-149358834 AGGCAAATGCATCATGGGGGTGG + Intergenic
1200531033 Y:4338423-4338445 GGGGATATTGATAATGGGGGAGG + Intergenic
1201015482 Y:9597311-9597333 TAGCATATGAATAATGGAAGGGG + Intergenic