ID: 977656732

View in Genome Browser
Species Human (GRCh38)
Location 4:99530915-99530937
Sequence CAAAGTGGCCAGAGTGTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977656732 Original CRISPR CAAAGTGGCCAGAGTGTAGC AGG (reversed) Intronic
901117302 1:6857537-6857559 CAAAGAAGCCAGAAAGTAGCAGG + Intronic
902383665 1:16064505-16064527 CAAAGTGGACAGAGTGGAGAGGG - Intronic
902682507 1:18053506-18053528 TAAAATGGGCAGAGTGTAGATGG - Intergenic
902961170 1:19963713-19963735 CAGAGTGGCTGGAGTGAAGCGGG - Intergenic
903266581 1:22161441-22161463 GAAAGAGGACAGAGTGTAGCTGG + Intergenic
904205936 1:28855344-28855366 CAAAGAGGCCAGTGTGTGGCAGG + Intronic
904314417 1:29651051-29651073 TACTGTGGCCAGAGTGGAGCTGG - Intergenic
904466250 1:30709444-30709466 AAAAGTGCCCAGAGTGGTGCCGG + Intergenic
904743289 1:32695113-32695135 CAAACTGGGCAGAGAGTCGCCGG + Exonic
906909113 1:49927081-49927103 CAATGTGGCCAGAATGTTGCAGG - Intronic
909976596 1:82052830-82052852 CAAATTGGGCTGAGTGTAACTGG - Intergenic
911432042 1:97802074-97802096 CAAAGAAGCCAGATTGTAGTGGG + Intronic
914802165 1:150969780-150969802 GGAAGTGGCCAGAGTGTAGGGGG - Intronic
921540698 1:216411176-216411198 CAAAGTGGTTAGAGTGTCGCTGG - Intronic
1069650010 10:70039973-70039995 CAAAGTGCCCAGATTATAGGTGG - Intergenic
1073012357 10:100371407-100371429 CTCTGTGGCCAGGGTGTAGCTGG - Intergenic
1078729435 11:13962449-13962471 CAGAGGGTCCGGAGTGTAGCTGG + Intergenic
1078907381 11:15700109-15700131 GAAAGGGGACAGAGTGCAGCAGG - Intergenic
1081444451 11:43116982-43117004 GAAAGGGGCCAGAATATAGCTGG - Intergenic
1081652017 11:44830529-44830551 GAATGTGGCCAGACTGTGGCTGG - Intronic
1083479415 11:62934056-62934078 CAGAGTGGCCAGAGTGGGGTGGG - Intergenic
1090978773 11:131698233-131698255 CTAGGTGGCCAGGGTATAGCAGG - Intronic
1091740572 12:2958574-2958596 CAAAGAGCTCAGAGTTTAGCTGG - Intergenic
1092097628 12:5856691-5856713 CAAAGTGTCAAGAGAGAAGCTGG + Intronic
1092111285 12:5966594-5966616 CACAGTGGCCAGAGGGGAGGGGG - Intronic
1092148113 12:6228779-6228801 AAAAGTAGCCAGGGTGTGGCTGG - Intronic
1093747118 12:22754692-22754714 CAAAGTAGTTAGAATGTAGCAGG - Intergenic
1100357866 12:93849007-93849029 CTAAGAGGCCATAGGGTAGCAGG - Intronic
1101598756 12:106190090-106190112 CATAGAGGCCAGAGGGTGGCTGG + Intergenic
1102877592 12:116459871-116459893 GAAAGTGGCAAGAAAGTAGCTGG - Intergenic
1104642736 12:130477880-130477902 CCCTGTGGCCAGAGTGCAGCTGG - Intronic
1104647584 12:130508377-130508399 CATAGTGGCAACAGGGTAGCAGG - Intronic
1106705951 13:32279569-32279591 CAAAGTGGCAAGAGTGGTTCAGG + Intronic
1107400741 13:40066560-40066582 CAAAGTGGCTAGAATAAAGCAGG - Intergenic
1109723413 13:66306830-66306852 AAATGTGGCCAGATTGTAGAGGG - Intronic
1113387343 13:109860965-109860987 CAAAGAGCTCAGAGTCTAGCAGG - Intergenic
1113864542 13:113512452-113512474 CTCAGTGGCCGGAGTGTAGATGG + Intronic
1113864613 13:113512787-113512809 GAAGGGGGCCAGAGTGTAGACGG + Intronic
1113864630 13:113512855-113512877 GAAGGGGGCCAGAGTGTAGATGG + Intronic
1115924063 14:38411364-38411386 CACAATGGCCAGAGGCTAGCAGG + Intergenic
1118448252 14:65871294-65871316 TAGAGTGGCCAGAGAGGAGCAGG + Intergenic
1119533261 14:75378610-75378632 CAAAGTGTCCAGGGTGTTGCAGG + Intergenic
1120545919 14:85811258-85811280 CAAAGAGGCCAGAGTGAATAAGG + Intergenic
1120877020 14:89384293-89384315 CAAAGTGAGCACAGTGAAGCAGG - Intronic
1120898028 14:89551705-89551727 CACAGTGTCCAGTATGTAGCAGG + Intronic
1120993857 14:90400174-90400196 AAAACTGCCCAGACTGTAGCGGG - Intronic
1121307952 14:92918626-92918648 CAGAGAGGCCGGAGTGTGGCAGG + Intergenic
1123108255 14:105852897-105852919 CAAAGGGCCAAGAGTGTGGCGGG + Intergenic
1126325449 15:47472178-47472200 CAAAGGGGCCAAAGTGCTGCCGG + Intronic
1128811308 15:70574834-70574856 CAAATTGGACAGAGTGTTGGAGG - Intergenic
1129845524 15:78766182-78766204 CAAAGGGGGCAGCGTGGAGCTGG + Exonic
1130256327 15:82327677-82327699 CAAAGTGGGCAGCGTGGGGCTGG - Intergenic
1130598625 15:85262311-85262333 CAAAGTGGGCAGCGTGGGGCTGG + Intergenic
1131490371 15:92857448-92857470 CAAAGTGCTCAGAGTCTAGTTGG + Intergenic
1131514324 15:93067013-93067035 TTGAGTGGCCACAGTGTAGCAGG - Intronic
1132657448 16:1047136-1047158 CCACGTGGCCAGGGTGTGGCAGG + Intergenic
1137574660 16:49590849-49590871 CAGAGTGGCCAGAGTGGTGGTGG - Intronic
1143086694 17:4421444-4421466 GAAAGGGGCCACAGGGTAGCCGG - Intergenic
1144949931 17:18988665-18988687 CAAGGAGGGCAGAGCGTAGCCGG - Intronic
1146006078 17:29161586-29161608 CACATTGGCCAGGGTTTAGCTGG + Intronic
1146063261 17:29617944-29617966 CCAAGAGGCCAGAGCGGAGCGGG - Intronic
1146377837 17:32306568-32306590 TAATTTGCCCAGAGTGTAGCAGG - Intronic
1149409235 17:56387438-56387460 CCAAGTGGCCAGATTTTATCTGG + Intronic
1150292217 17:63988469-63988491 CAGAGTGGCCTGAGTGGAGTTGG - Intergenic
1154308951 18:13253030-13253052 CAGGGTGCCCAGAGTGAAGCAGG - Intronic
1155162694 18:23208504-23208526 AAAAGGGGTCAGAGTGGAGCTGG + Intronic
1159766004 18:72489223-72489245 CAGAGAGGCCAGAGTGTGGGGGG + Intergenic
1164858627 19:31544904-31544926 CTAAGTGGCCAGAGTGAAGAGGG - Intergenic
1164946295 19:32295850-32295872 AAAAGTGGCCAGGAGGTAGCAGG - Intergenic
1166014128 19:39967348-39967370 CAAAGGGGCCAGAGAGAACCTGG + Intergenic
1166023784 19:40059117-40059139 AAAAGTGGCAAAACTGTAGCAGG + Intergenic
1166275335 19:41749683-41749705 CAAAGTGGCAGGAGTGCAGGGGG - Intronic
1166280359 19:41788480-41788502 CAAAGTGGCAGGAGTGGAGGGGG - Intergenic
1166396382 19:42444264-42444286 CAAAGTGGCAGGAGTGCAGGGGG + Intergenic
925154156 2:1637388-1637410 CAGAGTGGACAGCGTGTGGCAGG - Intronic
925154165 2:1637462-1637484 CAGAGTGGACAGCGTGTGGCAGG - Intronic
925154179 2:1637536-1637558 CAGAGTGGACAGCGTGCAGCAGG - Intronic
925154201 2:1637684-1637706 CAGAGTGGACAGCGTGTGGCAGG - Intronic
925154217 2:1637759-1637781 CAGAGTGGACAGCGTGTGGCAGG - Intronic
926998608 2:18768419-18768441 CAAAGTAGCCAGAAGGTAGGGGG - Intergenic
927370649 2:22351368-22351390 CAAAGTGTCCAGAATCTAGTAGG - Intergenic
932129126 2:69171648-69171670 CATAGTGGCCAAAGTGCACCTGG + Intronic
934656912 2:96121179-96121201 CAAAGGGGTCAGAGAGTAGGTGG - Intergenic
935688946 2:105713119-105713141 CAAAGTGGCCAGATGTGAGCTGG + Intergenic
936038886 2:109134096-109134118 CAAAGTGCCCAGCATGCAGCAGG - Intronic
938181624 2:129189844-129189866 TAGGGTGGCCTGAGTGTAGCAGG + Intergenic
939003458 2:136761012-136761034 GAAAATGGCAAGAGTGTAACAGG - Intergenic
941409487 2:165136254-165136276 GAAATTTGCCAGAGTGAAGCAGG - Intronic
1169041153 20:2496659-2496681 GAAAGTGGACACAGTGTAGGTGG + Intronic
1169760045 20:9081429-9081451 CACAGTGTCCACAGTGCAGCAGG - Intronic
1170810521 20:19670429-19670451 CAAAATGGCCAGAGAGAACCTGG + Intronic
1171359012 20:24573573-24573595 CAAAGTGACCAGGGCGCAGCAGG - Intronic
1172216388 20:33238602-33238624 CAAAATGACCACAGTGTAGTGGG - Intronic
1173403834 20:42747932-42747954 CAATGGGGCAAGAGTGGAGCAGG + Intronic
1176222586 20:63977118-63977140 CATAGTGGTCAGAGTACAGCCGG + Exonic
1178159338 21:29893828-29893850 CAAAGAGGCCTGAGTGAATCAGG + Intronic
1178955048 21:37014458-37014480 TAAAATGGACAGAGTGTAGATGG - Intronic
1180869389 22:19137807-19137829 CACAGAGGCCAGAGTGCAGAGGG + Intronic
1182571212 22:31239763-31239785 CAAAGTGCCTAGAATGTAGTGGG + Intronic
1184871139 22:47239196-47239218 GAGAGTGGCCAGAGTCTTGCTGG + Intergenic
950714333 3:14837033-14837055 CACAGTGACCAGACTGCAGCAGG + Intronic
952088916 3:29860630-29860652 CAAAGTGGTCACAGTCTAGAAGG - Intronic
952413105 3:33066918-33066940 AAAAGTGGCCAGAATATAGAAGG + Intronic
955361011 3:58274961-58274983 CACAGTGCCCAGCGTGTTGCAGG - Intronic
958129945 3:89405519-89405541 AAAAGTGCTCAGAGTGTGGCAGG - Intronic
958190339 3:90176245-90176267 CTAAGTGGCTGGAGTATAGCTGG - Intergenic
958545605 3:95545293-95545315 AAAACTGGACAGAATGTAGCTGG - Intergenic
958765085 3:98358170-98358192 CAAATTGTCCAGACTGGAGCAGG - Intergenic
959010223 3:101066898-101066920 CAAAGAAGCCAGAATGTAACAGG + Intergenic
962393141 3:134991188-134991210 CAAAGTGGGCAGAGTCAAGGAGG - Intronic
977656732 4:99530915-99530937 CAAAGTGGCCAGAGTGTAGCAGG - Intronic
978740769 4:112135593-112135615 CAAAGTGCCCAGTATGTAGTTGG - Intergenic
983626818 4:169809938-169809960 CACAGTGTCCACAGTCTAGCGGG - Intergenic
985526015 5:402167-402189 CAAAATGGCCAGTTTGTAGGTGG + Intronic
986279634 5:6312938-6312960 GGATGTGGCCAGTGTGTAGCTGG + Intergenic
986488863 5:8269187-8269209 CAAAGTGGCCATATTGGAGGAGG + Intergenic
986564617 5:9099896-9099918 CAGAGTGTCGAGAGTGAAGCTGG - Intronic
988716842 5:33836820-33836842 CAAGGTGGCCAGAGCCTAGAGGG + Intronic
988778381 5:34497329-34497351 CAAAGGGAACAGAGTGCAGCTGG + Intergenic
989743083 5:44794615-44794637 CAAAGTGACCAGAGTGTCAGAGG - Intergenic
990318026 5:54602349-54602371 GAAAATGGCCATAGTCTAGCAGG + Intergenic
996042786 5:118834389-118834411 CAAAAGGGCAAGAGTGTAACAGG + Intergenic
997561051 5:134846309-134846331 CCAAGGGGCCCTAGTGTAGCCGG + Intronic
999268068 5:150279885-150279907 CAAGGTGGCCTGGGTGTAGCTGG + Intronic
1000663357 5:163963729-163963751 CAATGTCTCCAGAGTTTAGCAGG + Intergenic
1002397533 5:178969762-178969784 CAAACTGGGCAGAGTGGAGCTGG - Intergenic
1002836496 6:869273-869295 CAGAGTGCCCAGCGTGGAGCAGG + Intergenic
1002870218 6:1160346-1160368 CAAAAAGGACAGAGTGTTGCTGG + Intergenic
1004926189 6:20417254-20417276 GAAAGTGTCCAGTGTGGAGCTGG + Intronic
1005822297 6:29607891-29607913 CAGTGAGGCCAGAGTGCAGCTGG - Intronic
1016241704 6:141938917-141938939 CAAAGTTGCCAGAGTGTCATGGG + Intergenic
1016244606 6:141967221-141967243 AAAAGTGGCCAAGGTATAGCTGG - Intergenic
1016827019 6:148397884-148397906 CAAAGAGGCCACAGTTTAGTAGG + Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1017788143 6:157773302-157773324 CACTGTGTCCACAGTGTAGCTGG - Intronic
1018226193 6:161631041-161631063 CAAAGTTCCAAGAGGGTAGCAGG - Intronic
1018431468 6:163726051-163726073 GAAAGAGGCCACAGTGTAACCGG + Intergenic
1019485289 7:1286354-1286376 CAACGTGGCCGGAGTGGAGTGGG + Intergenic
1021924570 7:25521925-25521947 CAAAGTGGCCTGGGTGCTGCTGG - Intergenic
1022371856 7:29778944-29778966 CAAAGTTGCTAGACTGTTGCTGG - Intergenic
1022479328 7:30732930-30732952 CAACGTGGCCTGGGTGTGGCTGG - Intronic
1023736714 7:43242026-43242048 CCAAGTGGCCAGAGTGTCACAGG + Intronic
1024295287 7:47836860-47836882 AAAAGGGGCCACAGTGTAGTCGG + Intronic
1024686478 7:51751262-51751284 CAAAGTGCCTAGAGTGTGCCAGG - Intergenic
1026735672 7:72947014-72947036 CAATGGGGCCAAAGGGTAGCTGG - Intronic
1026786014 7:73301945-73301967 CAATGGGGCCAAAGGGTAGCTGG - Intergenic
1027108050 7:75417997-75418019 CAATGGGGCCAAAGGGTAGCTGG + Exonic
1032910381 7:136422409-136422431 TAAAGTGGGGAGAGTGTTGCGGG - Intergenic
1034832978 7:154325540-154325562 CAAATTAGCAAGAGTCTAGCTGG + Intronic
1035145641 7:156812815-156812837 CAAGGGGGCTAGAGTGTACCAGG - Intronic
1038581603 8:28753188-28753210 CAAGGTGGCCACAGTGTCACTGG + Exonic
1041561784 8:59226448-59226470 AAAAGTGGCCAGAGTGTTACTGG + Intergenic
1043988436 8:86721694-86721716 AAAATTGGCAAGTGTGTAGCTGG + Intronic
1045027460 8:98101399-98101421 CACAGAGGCCAGAGTACAGCTGG - Intergenic
1045837997 8:106546297-106546319 CAAAGTGAGCACAGTTTAGCAGG - Intronic
1049107017 8:140620358-140620380 AAAAGTGGCCAGAGTAGTGCAGG - Intronic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1049755221 8:144308522-144308544 AAACGTGGCCAGAGTGCGGCGGG + Intronic
1051816512 9:21113371-21113393 CACAGAGGCCAGAGGGTAGTGGG + Intergenic
1052341331 9:27367012-27367034 CAGAGTGGCCAGTCTGGAGCAGG - Intronic
1057962200 9:99467637-99467659 CAAATAGGCCAGAGTGCAGAGGG + Intergenic
1059955849 9:119515292-119515314 CAAGGTGGCAAGAGTGTATAAGG + Intronic
1060010850 9:120041675-120041697 CAAGGAGGCCAGAGTGTGGCAGG - Intergenic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1185793471 X:2945250-2945272 CCACGTGGCCAGAATGCAGCAGG + Intronic
1190294113 X:49014491-49014513 CAAAGTGCCCAGATTGCAGGTGG + Intergenic
1192239756 X:69319707-69319729 TAATGTGGCCAGCATGTAGCCGG + Intergenic
1194337357 X:92665007-92665029 CAAAGTCGCCAGAGTGTGAGAGG + Intergenic
1194430007 X:93791015-93791037 AAAAGGGGCCAGATTGTAACAGG - Intergenic
1197541914 X:127774508-127774530 CAAAGTGGCATGAGTGTAGGGGG - Intergenic
1199985746 X:152948910-152948932 TGAAGTGGGCAGAGTGGAGCAGG + Intronic
1200645779 Y:5781741-5781763 CAAAGTCGCCAGAGTGTGAGAGG + Intergenic