ID: 977660939

View in Genome Browser
Species Human (GRCh38)
Location 4:99585193-99585215
Sequence CTAAGCACTTACTGTGTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3811
Summary {0: 1, 1: 11, 2: 127, 3: 786, 4: 2886}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977660939 Original CRISPR CTAAGCACTTACTGTGTGCT AGG Intronic
Too many off-targets to display for this crispr