ID: 977661649

View in Genome Browser
Species Human (GRCh38)
Location 4:99594829-99594851
Sequence GGCCATTCCCATTGTGGGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977661644_977661649 8 Left 977661644 4:99594798-99594820 CCATAATCAAAGCAGTTGATTCA 0: 1
1: 0
2: 0
3: 11
4: 182
Right 977661649 4:99594829-99594851 GGCCATTCCCATTGTGGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977661649 Original CRISPR GGCCATTCCCATTGTGGGGC AGG Exonic
900386790 1:2414312-2414334 GGCCCCTCCCACTGTGAGGCTGG - Intergenic
902870031 1:19308351-19308373 GGGCAGTCCCAGGGTGGGGCAGG - Intronic
903839347 1:26227119-26227141 GGCACTTGTCATTGTGGGGCTGG + Intergenic
904808889 1:33150707-33150729 GGCAATTCCCACAGTGGGGTCGG + Intronic
907548395 1:55283373-55283395 AGACATTCCCATGGTGGGCCAGG - Intergenic
907724696 1:57008201-57008223 GGCCATTCTGATTATGGGGTGGG + Intronic
907919514 1:58899414-58899436 GGGCATTCCCAGTGTGCTGCTGG + Intergenic
910953960 1:92681303-92681325 ATCCATTCCCATTTTGGGGGAGG - Intronic
916407110 1:164508545-164508567 GGCCACTTCCATTGTGGGTAGGG + Intergenic
918104828 1:181407781-181407803 TGCCATTCCTATTGCTGGGCAGG + Intergenic
918175309 1:182038975-182038997 GGCCTTACCAATTGTGAGGCAGG + Intergenic
922868772 1:228883384-228883406 GGCAAGTGCCATCGTGGGGCAGG - Intergenic
923128955 1:231058082-231058104 GGCCATTCACATTCTGGATCAGG - Intergenic
924205183 1:241705005-241705027 CGCCACTCCCATTTTGGGGAAGG - Intronic
924460557 1:244254914-244254936 GGCCATTGCCACTGTGGTTCGGG - Intergenic
1064272819 10:13880532-13880554 GGCTCTCCCCATTGTGGAGCTGG - Intronic
1068165152 10:53321250-53321272 GCCCATTCACACTATGGGGCGGG + Intergenic
1069678814 10:70269189-70269211 GGCCTTTCTCTTTGTGGTGCTGG + Intronic
1070153529 10:73819619-73819641 TGCCATTCCCAGTGCGGAGCGGG + Exonic
1072825268 10:98599436-98599458 GGCCAGTCCAATAGTGGGACAGG + Intronic
1075406573 10:122199513-122199535 GGCCCTTCCCAGCCTGGGGCAGG + Intronic
1077050917 11:566395-566417 CCTCCTTCCCATTGTGGGGCTGG - Intergenic
1079934182 11:26597196-26597218 GGCCACTCCCAAGATGGGGCGGG + Intronic
1080182658 11:29443181-29443203 AGCCCTTCCCATTATGGGCCTGG - Intergenic
1084009240 11:66338499-66338521 GCCCCTTCCCGTTCTGGGGCAGG - Intronic
1084558726 11:69890719-69890741 GCCCATGCCCATTGTGGGAGAGG - Intergenic
1086927611 11:92657187-92657209 GCCCAATCCCATTCTGGGGTTGG - Intronic
1088689835 11:112316170-112316192 GGCCCTTCACATTGTGTGGGTGG - Intergenic
1089304289 11:117517010-117517032 AGCCATTCCCCTCGTGGGACAGG + Intronic
1090365953 11:126205717-126205739 GGACATCCCCATTGTGGAGAAGG - Exonic
1090755972 11:129792349-129792371 GGCAGTTATCATTGTGGGGCTGG - Intergenic
1090939458 11:131374288-131374310 GGCCATCCCCATTGGTGGGGTGG - Intronic
1091235786 11:134021198-134021220 GGTCATACGCATTGTGGGTCTGG - Intergenic
1095203200 12:39409624-39409646 GGGCATGGCCATTTTGGGGCTGG - Intronic
1105412437 13:20182373-20182395 GGGGATTCCCATTGCAGGGCAGG - Intergenic
1110197642 13:72808795-72808817 GGCCAGTCCCATTCTGTGCCAGG - Intronic
1110328801 13:74247960-74247982 TTCCAGTCCCATTGTGGCGCTGG + Intergenic
1112835820 13:103512953-103512975 TGCCACTTCCATGGTGGGGCAGG + Intergenic
1114362450 14:21989784-21989806 GGCCATTTCCTGTGTGGGGAAGG + Intergenic
1119197014 14:72724624-72724646 TCCTACTCCCATTGTGGGGCTGG - Intronic
1120857094 14:89222223-89222245 GCCTATGCCCACTGTGGGGCTGG + Intronic
1122405639 14:101499167-101499189 GGCCATTCGCCTTGAGGGCCAGG - Intergenic
1125566169 15:40680112-40680134 GGCAATTCCTAGTGTGAGGCTGG - Intergenic
1126358082 15:47817309-47817331 TGCCAGCCCCACTGTGGGGCAGG + Intergenic
1126585278 15:50280035-50280057 CTTCATTCCCATTGTGGGGAAGG - Intronic
1127838531 15:62810136-62810158 GTCCATTGCCACTGTGAGGCTGG + Intronic
1131015207 15:89052188-89052210 GGCCCACCTCATTGTGGGGCTGG + Intergenic
1133403987 16:5508704-5508726 TGCCATACCCAAGGTGGGGCGGG + Intergenic
1139571612 16:67816475-67816497 GGCCACACACTTTGTGGGGCTGG + Intronic
1141276500 16:82593242-82593264 GGCCTTTCCCATTCCAGGGCAGG - Intergenic
1141560544 16:84864908-84864930 GTCCCTTCCCCTTGTGGGACAGG + Intronic
1142403617 16:89873894-89873916 GGCCCTTGACGTTGTGGGGCGGG + Intronic
1144468326 17:15515099-15515121 GGCCATGCCCACTGTGGGTATGG - Intronic
1145723273 17:27091416-27091438 GGCCTATCCCATTCTGGGGCGGG + Intergenic
1148219289 17:45850505-45850527 GGCCAATCCCGGTCTGGGGCAGG + Intergenic
1149888926 17:60368511-60368533 GGCCATTGCGGTTGGGGGGCGGG + Intronic
1150917614 17:69452259-69452281 GCCCATTCTTATTGTGGGGATGG - Intronic
1153967382 18:10194302-10194324 GGCCATGCCTGTTGTGGGGTGGG + Intergenic
1156472613 18:37387228-37387250 GGCCATCCCGAGTGGGGGGCTGG + Intronic
1156483652 18:37451226-37451248 GGACAGGCCCATTGTGGGCCAGG + Intronic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1160605026 18:80043706-80043728 GGCCATTGCCATGGTGTGGGTGG + Intronic
1161768014 19:6217424-6217446 GGCCCTCCCCACTCTGGGGCAGG + Intronic
1162852548 19:13441922-13441944 GGCCATTTTCCCTGTGGGGCTGG - Intronic
1163424656 19:17234983-17235005 GGCCCCTCCCGTTGAGGGGCGGG - Intronic
1165971867 19:39638487-39638509 TGCCATTCCCATTGTAGGTCAGG + Intergenic
1166944037 19:46386278-46386300 GGCCCTGCCCATGGCGGGGCCGG + Intronic
1167591561 19:50406973-50406995 GGTCGTTCCCATTCTGGGGATGG - Exonic
1168667900 19:58218226-58218248 GGCCATTCCCAAGGTGGGAACGG - Intergenic
926721597 2:15965472-15965494 GGCTATTCCCGTTTTGGGACAGG + Intergenic
934084463 2:88498446-88498468 GGCCATTCCCTTCTTGAGGCTGG - Intergenic
935370691 2:102343496-102343518 GGCCATTCCCATTGTCTTGATGG - Intronic
937059478 2:118970808-118970830 GGCTCTTCCCATTTTGGGGCAGG - Intronic
937071737 2:119068595-119068617 GTCCATTCCCTTTGGGGAGCCGG - Intergenic
938674130 2:133613767-133613789 CGCCATTCCCATTTTGGTGAAGG - Intergenic
941304984 2:163853472-163853494 GTCCTTTTCCATTGTGTGGCAGG + Intergenic
944596600 2:201266798-201266820 GGAAACTCCCATTGTGGGACTGG + Intronic
948408448 2:237740601-237740623 GGCTTTTCCTATTGTGGTGCTGG + Intronic
948666333 2:239536886-239536908 GGCCAGTTCCATTGTGGATCTGG - Intergenic
948783383 2:240338563-240338585 TGCTATCCCCATGGTGGGGCAGG + Intergenic
948861083 2:240752844-240752866 GACCACTCCCACTGTGGGCCAGG + Intronic
1169251558 20:4064807-4064829 GGCTGTTCCCATTAAGGGGCAGG - Intergenic
1173028263 20:39329948-39329970 TTCCCATCCCATTGTGGGGCTGG - Intergenic
1175363672 20:58435349-58435371 GTCCATTGGCATTCTGGGGCTGG + Intronic
1175823431 20:61924127-61924149 GGCCTGTCCTGTTGTGGGGCCGG + Intronic
1175999725 20:62826377-62826399 GGCCATCGCCACTGTGGCGCAGG + Intronic
1176151859 20:63595559-63595581 GGCCATGGCCAGGGTGGGGCTGG + Intronic
1177773929 21:25547035-25547057 TGCCATTCACATTCTGAGGCAGG - Intergenic
1178482474 21:32991458-32991480 TCCCATTACCATTGTGTGGCTGG + Intergenic
1181549248 22:23627570-23627592 GGCCAGTCACTGTGTGGGGCTGG + Intronic
1181807928 22:25386214-25386236 GGCCAGTTCCCTTGTGGGGCTGG - Intronic
1182311678 22:29413001-29413023 GGCCAGTCACTGTGTGGGGCTGG - Intronic
1183380514 22:37488430-37488452 GGCCAGGCTCACTGTGGGGCAGG + Intergenic
1184747921 22:46466572-46466594 GGCCAGGCTCAGTGTGGGGCTGG - Intronic
953910590 3:46890895-46890917 TGGGATTCACATTGTGGGGCTGG + Intronic
956099387 3:65751361-65751383 GAGCATTCCCATTGTGTGGCAGG + Intronic
958070271 3:88601373-88601395 GGCCATTTCCACTGATGGGCAGG - Intergenic
959438606 3:106348966-106348988 GACTATTCCAATTGTGGGGAAGG + Intergenic
959885662 3:111497065-111497087 GGCCACTCCCAAGATGGGGCCGG + Intronic
960112907 3:113862874-113862896 TGGCATTCCCATTGTGTTGCAGG - Intronic
961817901 3:129560637-129560659 GGCCACACCCACTGAGGGGCTGG + Intronic
962754615 3:138458290-138458312 GCCCATCCCCATTTAGGGGCTGG + Intronic
967883519 3:194317925-194317947 GGTGATTCCCATTTTGGGGGTGG - Intergenic
977661649 4:99594829-99594851 GGCCATTCCCATTGTGGGGCAGG + Exonic
978513172 4:109543458-109543480 GGCCATTTGCTTTGTGAGGCAGG + Intergenic
978630798 4:110741951-110741973 GGCCATTCTCATTATGTGACTGG - Intergenic
979075220 4:116262092-116262114 GGCCATGCACATTGTGGGTAGGG + Intergenic
979649043 4:123107896-123107918 GGCCACTCCGATTGTGGCGCAGG - Intronic
982107316 4:152022282-152022304 GGCCATGCCCATCATGTGGCTGG + Intergenic
982477936 4:155875947-155875969 GGCCTTACCAATTGTGGAGCAGG + Intronic
984844803 4:184100375-184100397 GGACATTCCCACTGTGGAGGTGG - Intronic
985871478 5:2560885-2560907 GGCCATTGCCATAGTGAGGGCGG + Intergenic
985887729 5:2693118-2693140 GGCTTTTGCCATTGTGGGGGCGG + Intergenic
986002638 5:3642361-3642383 GGCCACTCCCAGAGTGAGGCAGG + Intergenic
987374318 5:17219022-17219044 GGCCACTCGCACTGTGGGGCGGG + Intronic
987515256 5:18898758-18898780 TGCCATTCCCATTATGGAGGAGG - Intergenic
994489297 5:100420917-100420939 GGCCTTACCAATTGTGAGGCAGG - Intergenic
997711682 5:136009687-136009709 GGCCATTCCCCATGTGGGAGCGG - Intergenic
999309099 5:150540102-150540124 GGTCATTCCCATAGTTGGACAGG - Exonic
1001447565 5:171797614-171797636 GGCCAACCCCACTGTGAGGCAGG + Intergenic
1001973606 5:175978476-175978498 GTCCATTCAGATGGTGGGGCAGG - Intronic
1002243827 5:177865303-177865325 GTCCATTCAGATGGTGGGGCAGG + Intergenic
1003034318 6:2629852-2629874 GGCTCATGCCATTGTGGGGCTGG - Intronic
1004881091 6:20009275-20009297 GGGCATTCTGGTTGTGGGGCAGG - Intergenic
1006023653 6:31133195-31133217 GGCCATGAACCTTGTGGGGCAGG - Intronic
1008640016 6:53452878-53452900 GGACATTCTCCTTTTGGGGCTGG + Intergenic
1014848630 6:126312497-126312519 GGCTATTGCCATTGTTGGTCTGG - Intergenic
1017319882 6:153078063-153078085 GGCGATTCACAATGTGGGCCAGG + Intronic
1018921688 6:168179951-168179973 ATCCCTTCCCTTTGTGGGGCGGG + Intergenic
1019848014 7:3525936-3525958 GGTAATTCACATTGTGGGCCAGG + Intronic
1024000464 7:45185980-45186002 GCACATTCCCTTTGTGGGCCTGG - Intronic
1025276084 7:57581796-57581818 GGCCCATCCCATTCTGGGGTGGG + Intergenic
1026848394 7:73710199-73710221 AGCCACCCCCATCGTGGGGCAGG + Intronic
1033031849 7:137834433-137834455 GGTTATTCCCATTGTGGTGCTGG - Intronic
1035315565 7:157995651-157995673 GCCCATGCCCTTTGCGGGGCTGG - Intronic
1035579605 8:731621-731643 GGCCATTCCCTGTGTCCGGCGGG - Intronic
1035684727 8:1514894-1514916 GGCTCTTCCCCTCGTGGGGCTGG - Intronic
1038318580 8:26508506-26508528 GGCCATTCCCAGTGAGGTCCAGG - Exonic
1039827383 8:41186531-41186553 GGGCTATGCCATTGTGGGGCAGG - Intergenic
1041635180 8:60134609-60134631 CTCCATTGCCTTTGTGGGGCAGG - Intergenic
1046497755 8:115036786-115036808 GGCCGCTCCCAGTGTGGGGCCGG - Intergenic
1048268034 8:133004814-133004836 GGCCATTCTCATGCTGGTGCTGG - Intronic
1049368606 8:142252881-142252903 GGCCACTGCCCTAGTGGGGCAGG + Intronic
1050294891 9:4195375-4195397 GGCCTCTCCGAGTGTGGGGCCGG - Intronic
1053170350 9:35874817-35874839 GGCCATTTCCATTGATTGGCAGG + Intergenic
1056665278 9:88576701-88576723 GCCCTTTCCCTTTGAGGGGCTGG - Intronic
1059344197 9:113617019-113617041 GGCCCTTCACCTTGTGGGGCTGG - Intergenic
1061393302 9:130329806-130329828 GGACACTGCCAGTGTGGGGCAGG - Intronic
1061876171 9:133545250-133545272 GGCCCTTCCCTTTATGGGGCGGG + Intronic
1062145586 9:134988015-134988037 TGCCATTCCCAGGGTGGGGAAGG - Intergenic
1062179046 9:135180806-135180828 TGCCCTTCCCACTGTGGGGCTGG + Intergenic
1062711206 9:137976090-137976112 GGCCATGCCCAGTGTGGGCTGGG + Intronic
1187369059 X:18689157-18689179 GTCCATTCCAATGGTTGGGCGGG + Intronic
1187543004 X:20216918-20216940 GGCCATTCAAATTATGGGCCAGG + Intronic
1188273951 X:28177927-28177949 TGCCCTTCCCTTTGTGGGACTGG - Intergenic
1190950158 X:55135722-55135744 GGCCAGACTCATTATGGGGCTGG - Intronic
1199536354 X:148907086-148907108 GGCCACTCCCAAGATGGGGCGGG - Intronic
1202183215 Y:22157197-22157219 GGGCATGCGCATTGTGAGGCAGG + Intergenic
1202208144 Y:22429204-22429226 GGGCATGCGCATTGTGAGGCAGG - Intergenic