ID: 977666464

View in Genome Browser
Species Human (GRCh38)
Location 4:99651009-99651031
Sequence TGCCCCCAATAAGCCCGAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 59}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977666464_977666466 -9 Left 977666464 4:99651009-99651031 CCTGCTCGGGCTTATTGGGGGCA 0: 1
1: 0
2: 0
3: 3
4: 59
Right 977666466 4:99651023-99651045 TTGGGGGCAATGGTAGCCACAGG 0: 1
1: 0
2: 2
3: 9
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977666464 Original CRISPR TGCCCCCAATAAGCCCGAGC AGG (reversed) Exonic