ID: 977666464

View in Genome Browser
Species Human (GRCh38)
Location 4:99651009-99651031
Sequence TGCCCCCAATAAGCCCGAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 59}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977666464_977666466 -9 Left 977666464 4:99651009-99651031 CCTGCTCGGGCTTATTGGGGGCA 0: 1
1: 0
2: 0
3: 3
4: 59
Right 977666466 4:99651023-99651045 TTGGGGGCAATGGTAGCCACAGG 0: 1
1: 0
2: 2
3: 9
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977666464 Original CRISPR TGCCCCCAATAAGCCCGAGC AGG (reversed) Exonic
903291785 1:22318653-22318675 TGGCCCCACAAAGCCCGAGAGGG - Intergenic
1062855618 10:778182-778204 TGCCCCCACCAAGCAGGAGCAGG + Intergenic
1071413719 10:85421686-85421708 TCCCCTCAATAAGCCCAAGCAGG + Intergenic
1072727243 10:97822124-97822146 TGCCCCCCGTGAGCCCGGGCAGG - Intergenic
1073114767 10:101085523-101085545 TGGCCCCAAAAAGCCAGAGCAGG - Intergenic
1076138684 10:128062956-128062978 TGTCCCCAACAAGCCTGAGAAGG + Intronic
1076673390 10:132135373-132135395 TGCCCCCACTAACGCAGAGCAGG - Intronic
1080768363 11:35317494-35317516 TGCCAACAATATGCCCAAGCAGG - Exonic
1085051483 11:73382330-73382352 TGCCCCCAATCACCCTGACCTGG - Intronic
1085454570 11:76658473-76658495 TGGCCCCACATAGCCCGAGCAGG - Exonic
1089699828 11:120237903-120237925 GGCCTCCAATAAGCCCTTGCTGG + Intronic
1093062834 12:14625219-14625241 TCTACCCAAGAAGCCCGAGCTGG - Intronic
1096208421 12:49742453-49742475 TGACCCCAAGCAGCCCGGGCTGG - Intronic
1105274308 13:18905816-18905838 TGCCCCCAACCAGCCCTTGCTGG - Intergenic
1113817415 13:113183127-113183149 TGTCCCCAAAAAGCCAGCGCTGG - Intronic
1117875611 14:60248548-60248570 TGACCCCAGGAAGCCCAAGCAGG - Intronic
1122317728 14:100835747-100835769 TGCCCCCGACAAGCCCCTGCTGG + Intergenic
1122643981 14:103179402-103179424 TGCCCACACTGAGCCAGAGCTGG + Intergenic
1127256478 15:57297826-57297848 GGCCCCCAGTCAGCCCGGGCAGG - Intronic
1139582319 16:67880832-67880854 GGCCTCCATCAAGCCCGAGCTGG - Exonic
1143327727 17:6110362-6110384 TGCCAACAATAAACCAGAGCTGG - Intronic
1144480307 17:15623330-15623352 TGCCCCCAATATGTCCATGCAGG - Intronic
1144918002 17:18740409-18740431 TGCCCCCAATATGTCCATGCAGG + Intergenic
1147907298 17:43831728-43831750 TGCCCCCGAGGAGCCCGAGTGGG + Intronic
1154322011 18:13361819-13361841 TGCCCCCAGCCAGCCAGAGCAGG + Intronic
1154466004 18:14643071-14643093 TGCCCCCAACCAGCCCTTGCTGG - Intergenic
1156955136 18:42953537-42953559 TGCCCCTAATAGGCCAGAGTCGG - Intronic
1163003324 19:14382332-14382354 TGCCCCCAAGAAACCCAAGGTGG - Intronic
1163251268 19:16127675-16127697 TGCACCCAAGAAGCCCCGGCTGG - Intronic
1167528846 19:50002266-50002288 TGCCCTCAAGAAGCTCCAGCTGG + Intronic
927708712 2:25312418-25312440 TGCACCCAGTCAGCCAGAGCAGG - Intronic
1172857306 20:38015327-38015349 TGGCCCCAAGAAGCCAGAGAAGG + Intronic
1173241005 20:41297267-41297289 TTCCCCCAATAGGCCTGAGTTGG + Intronic
1174563540 20:51448193-51448215 TGCCCCCAAGAAAACAGAGCCGG + Intronic
1176808582 21:13515525-13515547 TGCCCCCAACCAGCCCTTGCTGG + Intergenic
1180020846 21:45125590-45125612 TTCCCCCAATGAGTCCCAGCAGG - Intronic
1180626779 22:17199024-17199046 TGCCCCCCATTAGCCAGAGTTGG - Intronic
1180955828 22:19740807-19740829 TGCCCCCACAAGGCCCGGGCGGG - Intergenic
952873868 3:37925451-37925473 AGCCTCCAACAAGCCCCAGCGGG - Intronic
954141642 3:48609818-48609840 TGCCGTCCATCAGCCCGAGCAGG + Exonic
955128086 3:56134755-56134777 TGTCCCAAATAAGCCAGAGAAGG - Intronic
955503359 3:59606793-59606815 TGCCCCAAATTAGCCCAAACAGG - Intergenic
955931096 3:64057775-64057797 TGCCCCCAATTTGCCCAAGAAGG + Intergenic
957193733 3:77040971-77040993 TGCCCCCAAGGAGCCCGTGCCGG - Intronic
959121930 3:102242739-102242761 TTTCCCCCATAAGCCTGAGCAGG - Intronic
959132924 3:102380362-102380384 TTCCCACAAGAAGCCAGAGCTGG - Intronic
975197394 4:71541642-71541664 TGACCCCATCAAGCCCAAGCTGG - Intronic
977666464 4:99651009-99651031 TGCCCCCAATAAGCCCGAGCAGG - Exonic
985517180 5:353089-353111 TTCTCCTAATAAGCCAGAGCAGG - Intronic
1002092652 5:176814057-176814079 TGCCACAAGTAGGCCCGAGCTGG - Intronic
1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG + Intergenic
1004614782 6:17280428-17280450 TGGCCCCAAAAAGCCAGTGCGGG - Intergenic
1005831396 6:29673638-29673660 TGCCCCCTATCTGCCCCAGCTGG - Exonic
1033280057 7:139999717-139999739 TGCCCTCTAGAAGCCGGAGCTGG - Intronic
1042490658 8:69393904-69393926 TCCCCCCAAAAACCCCCAGCTGG + Intergenic
1042968263 8:74379146-74379168 TGCCCTCAAAAAGCCTGAGTCGG - Intronic
1043370317 8:79583790-79583812 TGGCCCCATTTAGCCAGAGCTGG - Intergenic
1043916996 8:85934313-85934335 GGCCCCCAATAATCCCCACCTGG - Intergenic
1047113032 8:121811994-121812016 TACCACCACTAAGCCAGAGCAGG - Intergenic
1060920207 9:127415052-127415074 TTCCCCCTGTAAGCCAGAGCGGG - Intergenic
1185970635 X:4658679-4658701 TGCCCTCAATAAGCCTGGGTTGG + Intergenic
1190599660 X:52077411-52077433 TGCTCCCAATACGCCTGAACTGG + Intergenic
1192351679 X:70361142-70361164 TGCCCCCAATAGGCTCGAAGCGG - Intronic