ID: 977669324

View in Genome Browser
Species Human (GRCh38)
Location 4:99677668-99677690
Sequence AGAAATAAGCAGAGGAAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977669324_977669327 5 Left 977669324 4:99677668-99677690 CCCAACTTCCTCTGCTTATTTCT No data
Right 977669327 4:99677696-99677718 TTCAGCCTCCTTCTCTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977669324 Original CRISPR AGAAATAAGCAGAGGAAGTT GGG (reversed) Intergenic
No off target data available for this crispr