ID: 977669327

View in Genome Browser
Species Human (GRCh38)
Location 4:99677696-99677718
Sequence TTCAGCCTCCTTCTCTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977669325_977669327 4 Left 977669325 4:99677669-99677691 CCAACTTCCTCTGCTTATTTCTC No data
Right 977669327 4:99677696-99677718 TTCAGCCTCCTTCTCTCTGCTGG No data
977669326_977669327 -3 Left 977669326 4:99677676-99677698 CCTCTGCTTATTTCTCTGTTTTC No data
Right 977669327 4:99677696-99677718 TTCAGCCTCCTTCTCTCTGCTGG No data
977669324_977669327 5 Left 977669324 4:99677668-99677690 CCCAACTTCCTCTGCTTATTTCT No data
Right 977669327 4:99677696-99677718 TTCAGCCTCCTTCTCTCTGCTGG No data
977669323_977669327 24 Left 977669323 4:99677649-99677671 CCAGACTCTCACTGCTTCACCCA No data
Right 977669327 4:99677696-99677718 TTCAGCCTCCTTCTCTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977669327 Original CRISPR TTCAGCCTCCTTCTCTCTGC TGG Intergenic
No off target data available for this crispr