ID: 977676774

View in Genome Browser
Species Human (GRCh38)
Location 4:99756844-99756866
Sequence CTCCACTGAGAACCAGCCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977676774_977676779 21 Left 977676774 4:99756844-99756866 CCGGGGGCTGGTTCTCAGTGGAG No data
Right 977676779 4:99756888-99756910 TTTCTGTTTGTGTGACTAGAGGG No data
977676774_977676775 -2 Left 977676774 4:99756844-99756866 CCGGGGGCTGGTTCTCAGTGGAG No data
Right 977676775 4:99756865-99756887 AGAGAAAAGAGTTAAGTCCCAGG No data
977676774_977676780 28 Left 977676774 4:99756844-99756866 CCGGGGGCTGGTTCTCAGTGGAG No data
Right 977676780 4:99756895-99756917 TTGTGTGACTAGAGGGAAGCTGG No data
977676774_977676778 20 Left 977676774 4:99756844-99756866 CCGGGGGCTGGTTCTCAGTGGAG No data
Right 977676778 4:99756887-99756909 GTTTCTGTTTGTGTGACTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977676774 Original CRISPR CTCCACTGAGAACCAGCCCC CGG (reversed) Intergenic
No off target data available for this crispr